Ai Feedback
Exact(60)
First-strand cDNA synthesis was carried out by random priming of the total RNA using a random primer mixture (Invitrogen) and reverse transcriptase with superscript 3 (Invitrogen).
Reverse transcription of mRNA was performed with the mouse MGB IDO1 primer mixture (Gene Expression Assays: Mm00492586_m1) and mouse GAPDH primers (Applied Biosystems, Foster City, CA).
Each mutation-specific primer mixture was initially evaluated against both cloned lab-generated and patient-derived mutant virus sequences that were serially diluted 10-fold in backgrounds of wildtype sequence plasmids.
PCR amplifications were conducted in a total volume of 15 µl, comprising of 1 µl of the cDNA, 2 µl of primer mixture, and 12 µl of Plus Master Mix (Qiagen, HotStarTaq Plus).
For each array, total RNA (12.5 µg) obtained for each sample was reverse transcribed and labeled with amino-allyl dUTP using reverse transcriptase III and Oligo-dT/random primer mixture (Invitrogen, Carlsbad, CA).
To construct tau isoform with 383 amino acids, two PCR amplifications were conducted with the primer mixture of TauN and LE10-352, pGEX-2T-Tau352 pGEX-2T-Tau352 pGEX-2T-Tau352l as the mixtemplateE10-up asd TauC, using pET-17b-Tau441 as the template.
To construct tau isoform with 412 amino acids, two PCR amplifications were conducted with the primer mixture of TauN and E2-down, using pET-17b-Tau441 as the template, as well as the mixture of LE2-352 and TauC, using pET-17b-Tau383 as the template.
Briefly, to construct human tau isoforms with 381 and 410 amino acids, two PCR amplifications were conducted with the primer mixture of TauN and E2-down, or E3-down, using pET-17b-Tau441 as the template, as well as the mixture of LE2-352 or LE3-352 and TauC, using pGEX-2T-Tau352 pGEX-2T-Tau352 pGEX-2T-Tau352
The PCR mixture (50 µl final volume) contained the following: 25.5 µl sterile distilled water, 5 µl 10×PCR buffer (500 mmol/l KCl and 100 mmol/l Tris-HCl: pH 8.3), 4 µl of a deoxynucleotide mixture (dGTP, dTTP, dATP, and dCTP; 2 mmol/l each), 5 µl MgCl2 (2.5 mmol/l), 5 µl of a primer mixture (10 µmol/l each), 5 µl template DNA, and 0.5 µl AmpliTaq DNA polymerase (5 U/µl).
Standard DNA or DNA extracted from infected cells (40 ng) was added to 10 µL of SYBR Premix Ex Taq II Kit (TaKaRa, Otsu, Shiga, Japan), 1.6 µL of a thymidine kinase primer mixture (TK 290-F: 5' TCG CGA ACA TCT ACA CCA CAC AAC; TK 400-R: 5' CGG CAT AAG GCA TGC CCA TTG TTA; each at 400 nM), 0.4 µL Rox (TaKaRa) and PCR-grade water to a final volume of 20 µl per reaction.
The primer mixture was thoroughly mixed with a brush and then applied to each tooth.
Related(20)
primer composition
case mixture
bait mixture
primer preparation
primer hybrid
example mixture
primer solution
primer blending
primer combining
former mixture
primer mixing
first mixture
primer cocktail
primer primer
primer ctggatagcctttcttctgctg
primer list
primer optimization
primer pair
primer extension
primer paint
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com