Sentence examples for add restriction from inspiring English sources

Primers were designed to add restriction sites in order to facilitate further cloning.

These results add restriction of cancer stem cells as a new tumor suppressor activity attributed to p53.

PCR amplification of the VHH2-E-tag was performed to add restriction sites for ClaI and XhoI to the VHH2-E-tag using primers ClaI-VHH: 5'-GCCATTGGAACTTACTCTGAAAA-3' and XhoI-VHH: 5'-CCGCTCGAGTGCGGCACGCGGTTCC-3'.

Primers PM7F and PM7R were used to PCR amplify fliC S219C and the ParaBAD promoter from plasmid pBAD33-fliCS219C (gift of H Berg, [ Turner et al., 2010]) and to add restriction sites for AatII and SalI.

(13) Each amplified product was then re-amplified using the following primers to add restriction enzyme sites: 5′ CATGCCATGGGGGACATTGTGTTAACACAGTCTCC 3′ (forward) and 5′ GGCGGCGGCTGATTTCCAGTTTGGTCCCCCCTCC 3′ (reverse) for VL, and 5′GGATATCGAGGTGATGTTGGTGGAGTCGGGAGGAG 3′ (forward) and 5′ TCCCGGCGGCTGAGGAGACTGTGACCATGACTCCT 3′ (reverse) for VH.

Extra sequences were added in the primers to maintain the reading frame and/or to add restriction sites for cloning: for META1, TV494 with a BamHI and TV757 & TV758 with NcoI site respectively and for GFP, TV276 & TV277 with an NcoI and XbaI site respectively.

To add restriction sites for cloning, 100 ng of the purified and pooled VH, kappa or lambda PCR products of the first PCR for each of the 27 second PCR reactions were used in a volume of 100 μL using GoTaq and 0.2 μM of each primer for 20 cycles (1 min 95°C, 1 min 57°C, 2 min 72°C) followed by a 10 min final synthesis step at 72°C.

In absence of a way to tackle bigger problems, it's easy to add restrictions.