Sentence examples for incorporating restriction from inspiring English sources

Exact(3)

We show not only specific capture of primary spleen cells on protein DNA microarray spots but also their fast and specific orthogonal release according to the antibody DNA combinations by incorporating restriction sites in DNA.

Two fragments of the gefE gene incorporating restriction sites were amplified by PCR (gefE_sal AGGC GTCGAC CACCCTATAGTCCAGATAC, gefE_nco AGG CATCGG AATCTCTGTTGGATC, gefE_pst ATG CTGCAG CAGTTTCTGATCGACC, gefE_not ATA GCGGCCGC CGTTGATTATGAGCAT) and cloned into pLPBLP, one on each side of the floxed blasticidin.

The ASFV ORF I329L (accession number NP_042833) was obtained by PCR amplification from DNA of the tissue-culture-adapted non-pathogenic ASFV isolate Ba71V (Uniprot database, code I329_ASFB7) with primers incorporating restriction sites for BamHI upstream and EcoRV downstream of the ORF and using the high-fidelity enzyme Pfu DNA polymerase.

Similar(57)

The primers were modified to incorporate restriction sites (underlined) for XhoI and HindIII, respectively.

One approach to circumvent this problem is to incorporate restriction endonuclease sites into the oligos used during cDNA synthesis.

The initial plant transformation vector pNML54 (GenBank: FJ410917) was created by amplifying the SpR marker from pEU904 [ 45] using the PCR and primers SpR-5'-HpaBspNhe and SpR-3'-Hpa to incorporate restriction sites.

Therefore using this system, no cost or delay is typically required for sequencing the clone as is generally required when a PCR step is used to incorporate restriction enzyme sites to enable conventional cloning of a DNA fragment.

The pENTR2B (Invitrogen) derivative pJM1 (GenBank: FJ391469) was created by amplifying the TcR marker from pACYC184 [ 44] using the PCR and primers Tc-5'-PmlNco and Tc-3'-PmlNsi to incorporate restriction sites.

Each primer set was designed to incorporate restriction sites (underlined above) such that NdeI is part of the start codon and BamHI or BglII is downstream of the gene.

In order to incorporate restriction site sequences at each termini of the 601 sequence, plasmid DNA was used as a PCR template using the following primers: forward 5′ – CTCGGAATTCTATCCGACTGGCACCGGCAAG – 3′ (EcoRI) and reverse 5′ – GCATGATTCTTAAGACCGAGTTCATCCCTTATGTG – 3′ (Bst98I).

Primers were designed to incorporate restriction enzyme sites to allow directional cloning of ilvC, panC and panE coding sequences into pUC19, in frame and downstream of the lacZ start codon; thus, generating pUC19 expression constructs containing ilvC, panC and panE coding sequences under the control of the lacZ promoter (primer sequences are shown in Additional file 1: Table S1).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: