Sentence examples similar to appended restriction from inspiring English sources
The N-terminal TAPi tag was amplified with a high-fidelity polymerase from the gateway cloning vector ntapi.289.gw using the following primers designed to append SalI restriction overhangs: Forward: AAGTCGACCGTGGTGGACAACAAGTTCAA Reverse: TTGTCGACGAAGAAGATCCTCCTCCTCCCAGTGCGCCGCTG Adenosine overhangs were added with Taq polymerase, and the fragment was cloned into pCR2.1.
The light- and heavy-chain Fds were spliced by PCR overlap extension with primers appended with SfiI restriction sites, as described above.
PCR primers with the restriction sites NdeI and BamHI appended were used to clone three μ1 constructs: μ full-length (1 423), μ121 (121–423) and μ158 (158–423).
The numerical computation appended below verifies these ratios under suitable restrictions, and gives bounds of ratios otherwise readily available.
The genes were appended with a 5'-methionine codon, a 5'-FatI restriction site spanning the ATG start, and a 3'-XhoI restriction site immediately following the terminal serine codon (appends a non-native, C-terminal LeuGlu sequence).
Subsequently, the cDNA was amplified, digested with one of two restriction enzymes, and the appropriate Illumina-based sequencing adapter appended to the digested molecules by ligation.
House Republicans had appended unrelated provisions to the bill – involving, for instance, abortion restrictions and the Confederate flag – and Senate Democrats refused to pass it in its altered form.
Human and mouse variants of an E A fusion protein appended to the human Interleukin-2 signal peptide were cloned into the mluI/AatII restriction site of the parental MV-NIS virus.
TNF receptor (R) II extracellular domain was amplified using a backward antisense primer, 5'-TTTTCCTTTTGCGGCCGCTCATTA-3'; and a forward sense primer, 5'-GGGTAGTAGCTCTTCCGGCTCATCGTCCAGCGGCGTGCCCGCCAAGGTTG-3', which appended part of a 15 amino acid linker (SSSSG 3 at its N-terminus and a stop codon and NotI restriction site at its C-terminus.
