Sentence examples for mutations were added from inspiring English sources

Primers: Jak2cDNAF2: CACATAGGAACTATTCAGAGTCTTTC; Jak2MutR3: AGAATGTTCTCCTCTCCACAGTA (additional mutations were added to the primer to prevent amplification of unmatching sequences).

Nucleotide mutations were added to an accepted genealogy according to standard coalescent methods (Hudson 1990).

SPRED1 mutations were added to the database and edited using phpmyadmin (www.phpmyadmin.net).net

BTD mutations were added to the database and edited using phpMyAdmin software (www.phpmyadmin.net).net

These numerical values for low clonality and high clonality mutations were added together for all loci containing LOH in a microdissected target.

When all three TMD Cys mutations were added to the C6Z mutant to form a fully CL protein (CL-Pgp), the resulting protein exhibited at least 75% resistance against all three drugs relative to WT.

There is a diminishing marginal increase in reported IFs as more mutations are added.

In the third step the local trees for the two sites are computed and mutations are added.

(iii) Finally, neutral mutations are added to the branches of the genealogical tree according to a Poisson process.

Antibody or cold probe (either wt or containing point mutations) was added and the reaction incubated at room temperature for 1 h.

But as more random mutations are added, high-fitness genotypes become less common, and the average harm of multiple mutations is stronger than what the effect of single mutations indicated.