Sentence examples for mutations was added from inspiring English sources

Antibody or cold probe (either wt or containing point mutations) was added and the reaction incubated at room temperature for 1 h.

Primers: Jak2cDNAF2: CACATAGGAACTATTCAGAGTCTTTC; Jak2MutR3: AGAATGTTCTCCTCTCCACAGTA (additional mutations were added to the primer to prevent amplification of unmatching sequences).

There is a diminishing marginal increase in reported IFs as more mutations are added.

Nucleotide mutations were added to an accepted genealogy according to standard coalescent methods (Hudson 1990).

SPRED1 mutations were added to the database and edited using phpmyadmin (www.phpmyadmin.net).net

BTD mutations were added to the database and edited using phpMyAdmin software (www.phpmyadmin.net).net

In the third step the local trees for the two sites are computed and mutations are added.

(iii) Finally, neutral mutations are added to the branches of the genealogical tree according to a Poisson process.

These numerical values for low clonality and high clonality mutations were added together for all loci containing LOH in a microdissected target.

But as more random mutations are added, high-fitness genotypes become less common, and the average harm of multiple mutations is stronger than what the effect of single mutations indicated.

For deleterious mutations, synergistic epistasis means that the decline in average fitness accelerates as more random mutations are added (such epistasis is termed negative by Phillips et al. [ 1]).