Ai Feedback
Exact(27)
The new problem is called Variable Length Sequencing Problem (VLSP).
Near-full length sequencing of the 16S rRNA gene for the 28 bacteriocin producing LAB identified the isolates as follows: 24 strains of Ent.
Design PCR and sequencing primers for subsequent use in the development of an assay prototype that enables the full length sequencing of HLA-DRB1 Exons 2 and 3.
This was substantiated by full length sequencing of the XKRY gene showing nucleotide changes spread all across its length, though frequently in the middle portions (not shown).
Gene orientation and homology of reference, rs11045819 (T155P), rs2306283 (D130N), and rs4149056 (V174A) SNPs1B1 SNPs were confirmed through direct full length sequencing of clones prior to experimentation.
Complete full length sequencing of all 8 segments was performed on at least 5 cDNA clones for each segment and a consensus sequence for each virus was produced; there was only very limited polymorphism in the analysed sequences.
Similar(33)
Out of 169 bacterial isolates, 96 were carefully selected for full-length sequencing by avoiding duplicates within the treatments.
HRM was 94% concordant to full-length sequencing results, with most discrepancies attributable to mixed populations per HRM or transversions.
Isolated bacterial cultures (169 isolates) were grouped into different genera based on their short-length sequencing of 16S rDNA with 895F (CRCCTGGGGAGTRCRG), 47F (GCGCCAGGGAATTCTAAAAC) and 783R (ACCMGGGTATCTAATCCKG) primers.
Objective: The aim of this study was to evaluate the LiPA HIV-1 RT assay version 1 for monitoring drug resistance mutations in comparison to full-length sequencing.
Short-length sequencing of 169 bacterial isolates obtained from different organic formulations and PG ingredients (cow urine, cow dung and cow milk) revealed that the isolates were belonged to 43 different genera (Fig. 1).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com