Sentence examples for mice brain tissues from inspiring English sources

Normal and tumor mice brain tissues were collected after treatment with saline, vardenafil, Herceptin, and Herceptin plus vardenafil.

Primers used for PCR XIAP: Sense: 5'ggccagactatgcccattta3' Antisense: 5'cgaagaagcagttgggaaa3' β-Actin: Sense: 5'gtcgtaccactggcattgt3' Antisense: 5'cagctgtggtggtgaagct3' Single and co-cultures of glioma cells, siXIAP transfected cells or nude mice brain tissues were harvested and homogenized in four volumes of homogenization buffer as described previously [56].

Single and co-cultures of glioma cells or nude mice brain tissues were harvested and homogenized in four volumes of homogenization buffer (pH 7.4; 250 mM sucrose, 10 mM HEPES, 10 mM Tris-HCl, 10 mM KCl, 1% NP-40, 1 mM NaF, 1 mM Na3VO4, 1 mM EDTA, 1 mM DTT, 0.5 mM PMSF plus protease inhibitors: 1 µg/mL pepstatin, 10 µg/mL leupeptin and 10 µg/mL aprotinin) using a Teflon-fitted glass homogenizer.

Nine-month-old male P301S mice brain tissues were homogenized in TBS supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) as described previously.

Changes in affinity might be caused by differences in the secondary structures of Aβ peptides deposited in human and mice brain tissues.

Single and co-cultures of glioma cells or nude mice brain tissues were harvested and homogenized in four volumes of homogenization buffer and processed for cell lysates as described previously [ 27].

A sensitive and selective method was elaborated for the determination of the anticonvulsant compounds levels in mice brain tissue, based on HPLC with diode array detector (DAD).

Next, we evaluated XIAP expression in nude mice brain tissue lysates by immunoblotting.

Biological sample used here was total protein prepared either from the IPTG-induced BL21 or from fresh mice brain tissue.

Immunohistochemical analysis of PS2APP transgenic mice brain tissue 3 days after intravenous injection of gantenerumab showed dose-dependent binding to amyloid plaques.

The potential neuroprotective effects of the NAF are linked to inhibition of AChE and MDA production in mice brain tissue with Aβ-induced amnesia.