Sentence examples for mutation was added from inspiring English sources

A single-base mutation was added to the G-quadruplex domain to prevent the nonspecific SWCNTs assembly caused by the formation of the interparticle G-quadruplex.

However, when the ΔSD2 mutation was added, the triple mutant CV2-T5P/I21R-ΔSD2 (Figure 1K) lost both the pro- and anti-BMP activities, and had no effect of D V patterning at all (Figure 2A,H).

For autosomal dominant (AD) diseases, one heterozygous mutation was added, and for autosomal recessive (AR) diseases, one homozygous mutation was added to the whole-exome files.

To the resulting plasmid, the Y254V mutation was added to obtain the mutant D12A/D66A/Y254V-6His.

However, when the L409P mutation was added to the R558 polymorphism, more pronounced Na+ channel dysfunction was observed in case of the fetal splice variant.

Master mix with primers specific for the known ENU-induced mutation was added to the dried template in well 94 of each plate.

In the papers of Sella and Ardell, mutation is added in a deterministic way.

If there is consensus in the GeneTalk community that a certain mutation is pathogenic and its annotation is trustworthy, this mutation is added to the annotation track 'pathogenic'pathogenic

Antibody or cold probe (either wt or containing point mutations) was added and the reaction incubated at room temperature for 1 h.

Primers: Jak2cDNAF2: CACATAGGAACTATTCAGAGTCTTTC; Jak2MutR3: AGAATGTTCTCCTCTCCACAGTA (additional mutations were added to the primer to prevent amplification of unmatching sequences).

There is a diminishing marginal increase in reported IFs as more mutations are added.