Ai Feedback
Exact(6)
To determine whether β-TRCP recognizes either ZNRF3 or RNF43 in a degron-dependent manner, we mutated the putative degron motifs (ESG and/or SSG in ZNRF3; DSG in RNF43).
Moreover, when we mutated the putative NES of LC3, EGFP-LC3 mNES was still found in both the cytoplasm and nucleus, a result inconsistent with a functional role of the NES.
One of the important signalling pathways induced by TNFα results in the activation of transcription factor NF-κB. Therefore we mutated the putative NF-κB site in optineurin promoter and analysed the effect of this mutation on reporter activity.
To further confirm that the putative catalytic activity of Fam20A was not required for the increase in Fam20C-dependent substrate phosphorylation, we mutated the putative metal binding Asp of Fam20A (D430A).
To confirm this, we mutated the putative PD-binding site in each reporter construct to generate PRO1m-tk-luc, PRO2m-tk-luc, PRO3m-tk-luc, and PRO4m-tk-luc and then tested the responses of each to PAX3-FKHR expression.
To determine the specificity of this down-regulation, we mutated the putative miR-200c binding sites and observe that luciferase activity levels return to levels observed in the absence of miR-200c; thus, miR-200c binding to these sites specifically is required for down-regulation.
Similar(53)
Moreover, when mutating the putative active-site cysteine at position 313 to serine, covalent binding to the electrophile is abolished.
Mutagenesis PCR was performed to mutate the putative ApiAP2 binding site at −825/−818 of the 103464 promoter from TAGAACAA to TTATTATT.
As shown in Figure 4E, mutating the putative binding site on the UTR increased luciferase activity significantly, again suggesting that the down regulation of CXCL12 is effected by miR-886-3p miR-886-3p miR-886-3pg throughputative bindirectite.
Site-directed mutagenesis (Stratagene, Milan, Italy) or a two-round, PCR-based, site-specific mutagenesis approach were performed to mutate the putative Estrogen Receptor Response Elements (EREs) within the FLT1-T promoter construct.
Quickchange mutagenesis was performed on the entry clone containing the sup-26 3′ UTR using the primers CATCCACCGTTCCGTCATCGTCG and CTGCCGAGGAAAGGAGAATGAGTG to mutate the putative mir-35 family binding site.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com