Sentence examples for mutagenesis by using from inspiring English sources

Plasmid pFoldonTAG, which encodes the Trp68TAGfoldon mutant, was constructed by site directed mutagenesis by using the QuikChangeXL (Staratagene, La Jolla, CA) method and the corresponding HPLC-purified primers.

Generation of the GEF-dead variant (L386R/L387S) of the ARHGEF7 construct [32] was performed by a two step site-directed mutagenesis by using the oligonucleotide GATAAATACCCTACGCGGCTCAAAGAGCTCGAGA to introduce the L386R and thereafter the oligonucleotide GATAAATACCCTACGCGGTCCAAAGAGCTCGAGAGACA to introduce the L387S mutation.

The selected scFvs of first cycle were subjected to PCR-based random mutagenesis by using the error-prone PCR and staggered extension process (StEP) shuffling in tandem, according to the protocols described by Cadwell [37] and Zhao[38] to generate the initial mutant ribosome library of anti-Sulfanilamides scFvs.

This was done by site directed mutagenesis by using the QuickChange Site-Directed Mutagenesis kit (Stratagene).

Other plasmids were constructed by site-directed mutagenesis by using appropriate combinations of primers and template plasmids.

Sequence to be analyzed spanning 27 nucleotides centered on the different stop mutations were inserted in-frame between the Renilla and Firefly Luciferase coding sequences through site-directed mutagenesis by using the QuickChange II kit (Stratagene, La Jolla, California, USA).

Mutagenesis was performed by using the Quikchange mutagenesis kit (Stratagene, La Jolla, CA, USA) and the pol λ catalytic core was purified as described previously (Garcia-Diaz et al, 2005b).

The Ser27Ala mutagenesis was performed by using the Advantage-GC 2 polymerase kit.

Site-directed mutagenesis was performed by using the QuikChange Lightning Kit (Stratagene).

15 Site-directed mutagenesis was performed by using desalted DNA primers from Integrated DNA Technologies IDTT).

The primer used for mutagenesis was designed by using the Internet-based program Primer3 (http://frodo.wi.mit.edu/primer3/) and synthesized by IDT Integrated DNA Technologiess).