available when required

USAGE SUMMARY

The phrase "available when required" is correct and usable in written English.
You can use it to indicate that something can be accessed or utilized at any time it is needed. Example: "The support team is available when required to assist with any technical issues that may arise."

✓ Grammatically correct

Science

News & Media

Wiki

Human-verified examples from authoritative sources

Exact Expressions

15 human-written examples

The regulator must develop a consistent methodology for inspectors to follow that will ensure clinical experts are available when required.

The Guardian

"The bill eliminates zero-hour contracts by getting rid of unfair employment practices where employers do not commit any hours of work, but expect employees to be available when required without compensation".

The Guardian

Power from these resources may not be available when required.

Energy, Sustainability and Society

The milestone will be likely delayed by three days, such that the mobile crane is not available when required.

Visualization in Engineering

Immediate vaccination is most cost-effective, but requires vaccines to be available when required.

Plosone

Primer sequences are available when required, GAPDH-1 (GCCCAATACGACCAAATCTAA) and GAPDH-2 (ATTGTTGCCATCAATGACCC) are the primers from two HindIII restriction fragments of the GAPDH gene used for correcting different template amount.

Plosone

Human-verified similar examples from authoritative sources

Similar Expressions

45 human-written examples

Availability is the probability that a system is available for use when required.

Journal of Industrial Engineering International

Presence of use fees implied that health workers had resources available for use when required, as opposed to the public resources that have stringent guidelines for spending and accountability attached to them.

BMC Health Services Research

To ensure that GSCs are available for use when required, the cells were periodically cryopreserved and resuscitated during long-term culture and tested for their capacity to form new nonadherent tumor spheres upon retrieval.

BMC Cancer

The iris-scanning system will be available as an alternative when required.

The Guardian

The dynamic part of the confinement function shall be provided by safety important components that are available all the time when required.

Fusion Engineering and Design

Expert writing Tips

Best practice

When describing resources or services, use "available when required" to assure users that they can access them precisely when needed, ensuring efficient and timely use.

Common error

Avoid assuming "available when required" implies 24/7 access. Clearly define any limitations or specific conditions for availability to prevent confusion and unmet expectations.

Linguistic Context

The phrase "available when required" functions as a relative clause modifying a noun or pronoun. As Ludwig AI highlights, it indicates that something is accessible or ready for use precisely at the moment it is needed, emphasizing the conditionality of its availability. Ludwig provides several real-world examples, demonstrating its use across varied subjects.

Expression frequency: Common

Frequent in

Science

40%

News & Media

23%

Wiki

13%

Less common in

Formal & Business

13%

Academia

0%

Reference

0%

Ludwig's WRAP-UP

In summary, the phrase "available when required" is a grammatically sound and widely used expression. As Ludwig AI confirms, it serves to assure accessibility at a specific time of need. Its strength lies in conveying a sense of reliability and preparedness. While versatile, it's crucial to define the scope of availability to avoid ambiguity. The most frequent contexts where you can find "available when required" are within scientific literature, news articles, and WikiHows. It's advisable to consider alternatives like "accessible when needed" or "on demand" depending on the desired emphasis. In conclusion, using "available when required" correctly enhances clarity and builds confidence in the accessibility of resources.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

accessible when needed

Focuses on accessibility rather than general availability, implying a specific need triggers access.

on demand

Highlights the immediate availability and responsiveness of something.

as needed

Emphasizes the conditionality of availability, implying use only when necessary.

when necessary

Directly states that availability is contingent upon a specific need or requirement.

subject to availability

Highlights that availability may be limited or depend on certain factors.

ready for use when prompted

Adds a degree of activation by an external agent.

at one's disposal

Highlights that the element is under the control of someone.

present when called for

Emphasis on assistance and active role of the agent.

within reach

Highlights the easiness to access something.

at the ready

Emphasizes the preparedness and immediate usability of something.

FAQs

How can I use "available when required" in a sentence?

You can use "available when required" to indicate that something is accessible or ready for use only at the time it is needed. For example: "The emergency services are "available when required"".

What are some alternatives to "available when required"?

Alternatives include "accessible when needed", "on demand", or "as needed", each carrying slightly different nuances.

Is it better to use "available when required" or "available if needed"?

"Available when required" suggests a specific trigger or condition, while "available if needed" implies a more general or potential need. The best choice depends on the specific context.

What is the difference between "available when required" and "readily available"?

"Available when required" emphasizes the timing of availability based on a need, whereas "readily available" implies constant accessibility. "Readily available" suggests ease of access at any time.