Sentence examples for without promoter from inspiring English sources

Puromycin-polyA cassette without promoter would be stimulated by endogenous lncRNA promoter in cells with established targeted insertion, which could be depleted by Cre-mediated recombination (Fig. S4A).

Here a modified promoter trap vector containing puromycin-polyA cassette without promoter, a specific sgRNA targeting site and 4× MS2 tagging sequences were designed for targeted insertion at transcriptional start site (Fig. S1C).

In addition, a plasmid without promoter was used as a control.

We also noticed that in some cell lines (like HCC), OPMCL-v1 was silenced without promoter methylation detected by MSP.

For luciferase assays, cells were transfected with pGL3-Basic (Promega) without promoter (basal transcription control) or with the human E2f1 promoter cloned upstream the luciferase reporter.

Other mechanisms of gene silencing including gene deletion or mutation may lead to loss of protein expression - with or without promoter methylation.

The fluctuation and expansion predicted using these statistical and ANN models, for beds with and without promoters, were found to agree well with corresponding experiments.

Interestingly, we find that in practically all the investigated eubacterial and archaeal genomes, there is a trend for promoter DNA being more curved, less flexible, and less stable than DNA in coding regions and in intergenic DNA without promoters.

The vector backbone (pBBR-P−) was amplified from pBBR1MCS-3 (Kovach et al. 1995) without promoters, lac operator and lacZ gene and multiple cloning site using the forward primer AAAACTTAAGTGGGGTGCCTAATGAGTGAGCTAACTCAC and the reversed primer TTTAGATCTTAACCAATAGGCCGACTGCGATGAGTGG.

Various copper chromite catalysts with and without promoters were prepared by simultaneous co-precipitation and digestion technique and the role of promoters (Al, Ba and Zn) was investigated for hydrogenolysis of glycerol to 1,2-propylene glycol (1,2-PG) in both batch and continuous operations.

The specific hydrogen yields following induction of the plasmid-bearing strains are shown in Table 4. Strain ZF7, over-expressing of the fnr gene in W3110 background, exhibited an approximately 5.5-fold increase in specific hydrogen yield compared to the control strain ZF6 (containing the plasmid without promoter-driven gene expression).