underlined sections

USAGE SUMMARY

The phrase "underlined sections" is correct and usable in written English.
It can be used to refer to specific parts of a text that have been emphasized by underlining, often to highlight important information or to draw attention to certain details. Example: "Please pay special attention to the underlined sections in the report, as they contain the key findings."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

1 human-written examples

Our final 5' primer was TAATACGACTCACTATAGGGAGA TACTCATCTTGGTGGCCTG and our final 3' primer was TAATACGACTCACTATAGGGAGAGTGTTGAGACACCGTCAGACA (with the underlined sections being the T7 region).

Plosone

Human-verified similar examples from authoritative sources

Similar Expressions

59 human-written examples

The forward primer: 5′-TCCAGGTCTCTTCGATGTCC-3′ and reverse primer: 5′- CGATGTTAATACGACTCACTATAGGGCCGTATC-TCAGGCTCCACAG-3′ (underlined section indicates the T7 promoter and linker sequence) were designed in exon 4 of the 5-HT6R gene.

Development (Cambridge)

In the Library's fair copy, he underlined the sections that the Continental Congress changed.

Huffington Post

Underline sections of your notes or portions of your text that you don't understand well so you can raise your problems and discuss them with your classmates and teachers in class.

WikiHow

He had underlined the section, and double-underlined the word "not".

The New York Times

The memorandum's detailed attack on Clemens's testimony was underlined by the section dealing with lidocaine, a painkiller.

The New York Times - Sports

But the decision to treat most of the singers as Lee stand-ins locked into inferior copies of the original arrangements (a lone, pallid synthesizer substituted for a string section) underlined the degree to which no single performer could begin to pack the wallop that Lee summoned.

The New York Times - Arts

For notation purposes, driving gene names have been underlined in this section.

BMC Systems Biology

As we have underlined in the previous sections, this feature must be a very important property of the system that is planned to perform adaptive behavior.

The New Frontiers of Organic and Composite Nanotechnology

This section has underlined that civilians and their property are frequency the actual target of armed parties.

Journal of International Humanitarian Action

We have noted 31 summary suggestions for policy makers and planners, which are underlined in the previous section and Table 3.

BMC International Health and Human Rights

Expert writing Tips

Best practice

When referring to specific parts of a document that are underlined, ensure that the underlining is consistently applied and easily visible. This helps readers quickly identify the important information you are directing them to.

Common error

Avoid haphazardly underlining text without a clear purpose. Inconsistent or excessive underlining can confuse readers and diminish the impact of the emphasized sections. Always use underlining purposefully and sparingly.

Linguistic Context

The phrase "underlined sections" primarily functions as a noun phrase, referring to specific parts of a text that have been emphasized by underlining. As shown by Ludwig, it's used to direct attention to particular areas of importance.

Expression frequency: Common

Frequent in

Science

50%

News & Media

45%

Formal & Business

5%

Less common in

Wiki

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

In summary, the phrase "underlined sections" is a grammatically correct and commonly used noun phrase that effectively directs readers to emphasized portions of a text. As per Ludwig, it serves to highlight key details and guide focus, primarily within scientific and news-related contexts. While alternatives like "highlighted segments" and "emphasized parts" exist, "underlined sections" maintains a neutral to formal tone suitable for professional and academic environments. Effective use involves purposeful and consistent underlining to avoid reader confusion.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

underscored text

A direct synonym using a less common word for underlining.

highlighted segments

Focuses on the action of highlighting, implying a visual distinction.

emphasized parts

Indicates that the sections have been given importance or prominence.

noteworthy portions

Highlights sections that are particularly significant or interesting.

key segments

Emphasizes the importance and relevance of these sections.

important excerpts

Highlights selections which are crucial.

significant areas

Indicates sections of considerable importance.

marked passages

Focuses on the act of marking the sections, suggesting a deliberate action.

accentuated text

Highlights text that has been given prominence.

stressed segments

Indicates sections that are given particular emphasis.

FAQs

How to use "underlined sections" in a sentence?

You can use "underlined sections" to direct attention to specific parts of a text, such as: "Please review the "underlined sections" for key points" or "The most important information is in the "underlined sections" of the report."

What can I say instead of "underlined sections"?

You can use alternatives like "highlighted segments", "emphasized parts", or "key segments" depending on the context.

Is it necessary to explain why sections are underlined?

While not always necessary, briefly explaining why sections are underlined can enhance clarity. For example, stating "Underlined sections indicate key findings" provides immediate context.

Which is more formal, "underlined sections" or "highlighted sections"?

"Underlined sections" and "highlighted sections" are generally similar in formality. The choice often depends on the specific document and audience. Both are suitable for most professional and academic contexts.