spanning the region

USAGE SUMMARY

The phrase "spanning the region" is correct and usable in written English.
It can be used to describe something that extends or covers a particular area or space. Example: "The new park features a walking trail spanning the region from the river to the hills."

✓ Grammatically correct

Science

News & Media

Wiki

Human-verified examples from authoritative sources

Exact Expressions

60 human-written examples

The Turks are increasingly worried about what they regard as an Iran-sponsored Shiite axis spanning the region.

The New York Times

Three days into the strike by more than 86,000 employees of the nation's largest local telephone company, spanning the region from Maine to Virginia, the most strident and sometimes violent front lines of the walkout have been in New York City and its suburbs.

The New York Times

Five bacterial artificial chromosome (BAC) clones spanning the region were identified, and a BAC contig covering the Pi2-2 locus was constructed.

Rice

Today, with the grand Egnatia Odos Highway spanning the region completed, northern Greece is also getting easier - and quicker - to navigate.

BBC

The positional cloning of SUB1 was accomplished by identifying a contiguous set of BAC and binary clones spanning the region, using the intolerant indica Teqing and the tolerant FR13A derivative IR40931-26, respectively.

Rice

We also analyzed the pattern of distribution of these genes across the BAC/PAC clones spanning the region so that candidate genes can be short listed for a functional analysis.

Biotechnology Advances

Indeed, a broad and perfectly coherent ultra-flat supercontinuum spectrum spanning the region from 700 to 5200 nm is successfully generated by using a 25 kW peak power 100 fs input pulse pumped at 2.5 μm, in a waveguide of 5 mm length.

Optik - International Journal for Light and Electron Optics

Fine describes Aldimir's lands as spanning the region from modern Sliven in the east to Kazanlak or Karlovo in the west, just south of the Balkan Mountains.

Wikipedia

The construction of the Tamiami Trail, beginning in 1928 and spanning the region from Tampa to Miami, altered their ways of life.

Wikipedia

Not surprisingly, the most common region of overlap was that of 9p spanning the region of the jak2 gene.

Plosone

Primers spanning the region including all these sites were: forward primers AATCCCATCCTCCCATTCTC and TTTCACCAGCTCAGATCTCC; reverse primers GGAGATACAAGACCCTCATGG and CGAGAAGAGGAGATACAAGACCC.

Plosone

Expert writing Tips

Best practice

Use specific geographical locations or landmarks when possible to provide greater clarity and context when describing what "spanning the region" refers to.

Common error

Avoid using "spanning the region" without specifying what is being spanned. Vague usage reduces clarity. Instead of saying "developments spanning the region", specify which developments or define their parameters.

Linguistic Context

The phrase "spanning the region" typically functions as a present participle modifying a noun. It describes something that extends across a particular geographical area. Ludwig AI confirms its correct usage in various contexts.

Expression frequency: Very common

Frequent in

Science

60%

News & Media

15%

Wiki

10%

Less common in

Formal & Business

5%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "spanning the region" is a versatile expression used to describe something that extends across a particular geographical area. Ludwig AI indicates its correct and frequent usage across various domains. Its grammatical function is as a present participle, and its communicative purpose is to define geographical extent. While exhibiting a neutral to formal register, its prevalence in scientific and news contexts underscores its broad applicability. To ensure clarity, always specify what is extending or being covered when using this phrase.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

covering the area

Focuses on the extent of coverage rather than the act of extending.

extending across the region

Emphasizes the action of stretching or reaching over the area.

encompassing the region

Highlights the inclusiveness and completeness of the coverage.

stretching across the region

Similar to extending, but often implies a physical length or distance.

traversing the region

Suggests movement or passage through the area.

reaching across the region

Emphasizes the extent of reach or influence over the area.

covering the expanse

Highlights the broadness or vastness of the area covered.

overlaying the region

Implies a layer or surface covering the area.

distributed throughout the region

Indicates that something is spread or scattered throughout the area.

affecting the entire region

Focuses on the impact or influence on the whole area.

FAQs

How can I use "spanning the region" in a sentence?

Use "spanning the region" to describe something that extends or covers a particular geographical area. For example, "The new highway is "spanning the region" from the mountains to the coast."

What are some alternatives to "spanning the region"?

You can use alternatives such as "covering the area", "extending across the region", or "encompassing the region", depending on the specific nuance you want to convey.

Is there a difference between "spanning the region" and "covering the region"?

"Spanning the region" suggests a linear or extended connection across the area, while "covering the region" implies a more general presence or influence throughout the area.

What kind of subjects are best suited to be described as "spanning the region"?

Subjects that physically extend or have a continuous presence across a geographical area, such as roads, mountain ranges, or network infrastructures, are best described as ""spanning the region"".