restricted existence

USAGE SUMMARY

The phrase "restricted existence" is correct and usable in written English.
It can be used to describe a situation or condition where someone's life or options are limited or constrained in some way. Example: "The artist felt trapped in a restricted existence, unable to express her true self due to societal expectations."

✓ Grammatically correct

News & Media

Science

Human-verified examples from authoritative sources

Exact Expressions

2 human-written examples

Although Brontë spent most of her life in a remote Yorkshire village, she longed to travel beyond the horizon of her restricted existence.

The Guardian - Books

This criticism is slightly unfair to Dirac since the 18th-century biologists were making a very restricted existence claim, that mermaids exist now somewhere on earth, whereas Dirac's claim is spatiotemporally unrestricted.

SEP

Human-verified similar examples from authoritative sources

Similar Expressions

57 human-written examples

For many women, responding to the patriotic call of duty meant being liberated from their restricted, chaperoned existence in towns and cities.

Independent

French mathematician Poinćare was first to use the concept of fixed point in 'Poinćare's final theorem' during the period of 1895 to 1900, from restricting the existence of periodic solution for three body problem to the existence of fixed point under some conditions of planar continuous transformations.

Fixed Point Theory and Applications

The excessive exploitation of fossil oil and gas brings about the energy depletion and environmental pollution, which greatly restrict human existence and economic development [1, 2].

Applied Petrochemical Research

As results, a non-existence condition for special parameter sets and a characterisation of parameters for the existence, restricted by some derived bounds, are given.

European Journal of Combinatorics

It is better, then, to translate his existentially unloaded quantifiers as unrestricted quantifiers, and his existentially loaded quantifiers as quantifiers restricted by an existence predicate.

SEP

The BSG notes that neither Verizon nor AT&T are heavily promoting superfast broadband services — and suggests the commercial threat from online video services such as Netflix is likely far more front of mind for the companies than "the limited competition on broadband that is restricted by the existence of the territorial duopolies".

TechCrunch

In this line, cooperation between TFs has been restricted to the existence of DNA-binding sites close in the same promoter regions of target genes [ 9].

BMC Genomics

Distinctive features include large amorphous cells, an existence restricted to the host cell cytoplasm, a low GC content, a recoding of UGA from stop to tryptophan, and the unique 16S rDNA sequence CTAGTTATTAAATTAAAAATAAAATTTAGTAACG (positions 826 858, Escherichia coli numbering).

Genome Biology and Evolution

Transcripts for WEE1, which regulates entry into mitosis (Perry and Kornbluth, 2007), were detected with increasing levels in the CNT and the RNT, but were dorsally restricted, suggesting the existence of additional isoforms or of WEE1-like genes (Fig. 5A).

Development (Cambridge)

Expert writing Tips

Best practice

When using "restricted existence", consider the specific limitations or constraints you want to emphasize. For instance, physical limitations, societal restrictions, or emotional constraints.

Common error

Avoid using "restricted existence" in overly dramatic or sentimental ways. Reserve it for situations where the limitations are genuine and significant, not merely perceived inconveniences.

Linguistic Context

The phrase "restricted existence" functions primarily as a noun phrase, where "restricted" acts as a modifier specifying the nature of the "existence". It describes a state of being that is limited or constrained in some manner. As Ludwig AI confirms, it is grammatically correct and usable.

Expression frequency: Rare

Frequent in

Science

47%

News & Media

41%

Wiki

6%

Less common in

Encyclopedias

0%

Formal & Business

0%

Reference

0%

Ludwig's WRAP-UP

In summary, "restricted existence" is a grammatically sound phrase used to depict a life characterized by limitations or constraints. As verified by Ludwig AI, the phrase is correctly used in various contexts, including News & Media and Science, to describe situations where one's life or options are limited. While its frequency is relatively rare, the phrase is appropriate for conveying a sense of constraint or limitation. Remember to use it thoughtfully, avoiding melodramatic contexts and considering the specific type of restriction you wish to convey.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

Limited life

Focuses on the finite or curtailed nature of the life, emphasizing brevity or lack of opportunity.

Constrained living

Highlights the external pressures and limitations imposed on one's daily life.

Confined existence

Implies a lack of freedom and physical or metaphorical boundaries.

Circumscribed life

Suggests a life with well-defined limits, often imposed by external circumstances.

Sheltered life

Emphasizes protection from hardship or exposure to the wider world, implying a lack of real-world experience.

Inhibited lifestyle

Highlights the suppression of personal expression or freedom due to internal or external factors.

Controlled environment

Focuses on external regulation and manipulation of the surroundings, rather than the individual's internal state.

Bound existence

Suggests strong limitations or obligations that tie someone to a particular situation or place.

Fettered life

Implies being chained or restrained, emphasizing a loss of autonomy and freedom of movement.

Curtailed existence

Stresses the reduction or shortening of one's life experiences or opportunities.

FAQs

How can I use "restricted existence" in a sentence?

You can use "restricted existence" to describe a life that is limited or constrained in some way. For example: "The protagonist of the novel led a "sheltered life", shielded from the harsh realities of the world."

What are some synonyms for "restricted existence"?

Synonyms for "restricted existence" include "limited life", "constrained living", or "confined existence", depending on the specific nuance you want to convey.

Is "restricted existence" a formal or informal phrase?

"Restricted existence" is a relatively neutral phrase that can be used in both formal and informal contexts. However, consider the tone and context of your writing to ensure it is appropriate.

What's the difference between "restricted existence" and "limited existence"?

While similar, "restricted existence" implies that something is actively imposing limitations. "Limited existence" simply suggests that something is not as full or expansive as it could be.