Sentence examples for mutations are added from inspiring English sources

There is a diminishing marginal increase in reported IFs as more mutations are added.

In the third step the local trees for the two sites are computed and mutations are added.

(iii) Finally, neutral mutations are added to the branches of the genealogical tree according to a Poisson process.

But as more random mutations are added, high-fitness genotypes become less common, and the average harm of multiple mutations is stronger than what the effect of single mutations indicated.

For deleterious mutations, synergistic epistasis means that the decline in average fitness accelerates as more random mutations are added (such epistasis is termed negative by Phillips et al. [ 1]).

If mutations are added in the order they occurred in during the evolution, each successive mutation increases the fitness of the resulting strain, but adding mutations in different orders can reduce fitness.: adding the bem2∆ mutation increases the growth rate of bem1∆ bem3∆ nrp1∆ cells, but the same mutation reduces or has no effect on the fitness of all other tested genotypes.

Primers: Jak2cDNAF2: CACATAGGAACTATTCAGAGTCTTTC; Jak2MutR3: AGAATGTTCTCCTCTCCACAGTA (additional mutations were added to the primer to prevent amplification of unmatching sequences).

Nucleotide mutations were added to an accepted genealogy according to standard coalescent methods (Hudson 1990).

SPRED1 mutations were added to the database and edited using phpmyadmin (www.phpmyadmin.net).net

BTD mutations were added to the database and edited using phpMyAdmin software (www.phpmyadmin.net).net

Antibody or cold probe (either wt or containing point mutations) was added and the reaction incubated at room temperature for 1 h.