is best under

USAGE SUMMARY

The phrase "is best under" is correct and usable in written English.
It can be used to describe a condition or situation in which something performs optimally or is most effective. Example: "This software is best under high-performance conditions to ensure smooth operation."

✓ Grammatically correct

Science

News & Media

Wiki

Human-verified examples from authoritative sources

Exact Expressions

5 human-written examples

In Idaho, senators introducing a similar ultrasound bill added language on Monday requiring use of "whichever method the physician and patient agree is best under the circumstances".

The New York Times

Owl visual sensitivity permits some degree of vision under naturally-occurring nocturnal conditions, but nocturnal vision is best under moonlight [18].

Plosone

An important responsibility of being a technical advisor is to assemble evidence-based options for decision-makers to review and decide which option is best under the circumstances.

Global health, science and practice

If this proves to be the case, then further research will be undertaken to determine what type of communication is best under such circumstances.

BMC Medical Ethics

Make a decision about what is best under the circumstances.

WikiHow

Human-verified similar examples from authoritative sources

Similar Expressions

55 human-written examples

Thus, EOL care decision making is best under-stood as an ongoing process, rather than a one-time event, and should be revisited.

HIV/AIDS - Research and Palliative Care

This final was not about who was fastest, but who was best under pressure.

The Guardian - Sport

Overall reactor performance is predicted to be best under turbulent fluidization operation.

Chemical Engineering Science

Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful.

BMC Biotechnology

If they are over 6 (but under 8: this method of discipline is best for under 8's) tell them to walk to their rooms.

WikiHow

Liquid concealer is best for under eye circles.

WikiHow

Expert writing Tips

Best practice

When using "is best under", clearly specify the conditions or circumstances that lead to optimal performance. This provides clarity and avoids ambiguity.

Common error

Avoid using "is best under" without specifying the context or conditions. Saying "This method is best under any circumstance" is rarely accurate and can mislead the reader. Always provide specifics.

Linguistic Context

The phrase "is best under" functions as a descriptive phrase, indicating the conditions or circumstances under which something achieves its optimal state or performance. As Ludwig AI highlights, it is used to specify when something performs most effectively.

Expression frequency: Rare

Frequent in

Science

40%

News & Media

40%

Wiki

20%

Less common in

Encyclopedias

0%

Formal & Business

0%

Social Media

0%

Ludwig's WRAP-UP

In summary, the phrase "is best under" is used to denote the optimal conditions for something to function effectively. Ludwig AI confirms that it is grammatically sound. While relatively rare, appearing mostly in scientific, news, and wiki contexts, its usage is straightforward: specify the conditions that lead to the best outcome. When writing, be sure to avoid overgeneralization and provide specific details about the circumstances. Alternatives such as "is most effective in" or "functions optimally within" can be used to add variety to your writing.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

is most effective in

Emphasizes effectiveness rather than a general state of being "best".

performs ideally in

Highlights ideal performance within particular conditions.

functions optimally within

Focuses on the functionality and suitability of something within a specific context.

is optimized for

Implies that something has been specifically configured for optimal performance.

is particularly suited for

Indicates a strong alignment and aptitude for specific conditions.

operates most efficiently in

Highlights operational efficiency as a key benefit in specific conditions.

is at its peak during

Highlights the time or condition at which performance is best.

excels in the realm of

Emphasizes superior performance in a particular area.

thrives in circumstances of

Suggests that something not only functions well but also prospers.

achieves optimal results through

Focuses on the results achieved when something is used under certain conditions.

FAQs

How can I use "is best under" in a sentence?

Use "is best under" to describe scenarios or conditions where something performs optimally, such as "This strategy "is best under" specific market conditions".

What are some alternatives to the phrase "is best under"?

You can use alternatives like "is most effective in", "functions optimally within", or "performs ideally in" depending on the context.

Is it grammatically correct to say "is best under"?

Yes, the phrase "is best under" is grammatically correct and can be used to indicate optimal performance or suitability within specific conditions.

What kind of context is "is best under" most suitable for?

The phrase "is best under" is suitable for contexts where you need to specify the ideal conditions for something to work effectively, such as technical documentation, scientific reports, or practical guides.