inserting the following

USAGE SUMMARY

The phrase "inserting the following" is correct and usable in written English.
It can be used when you want to indicate that you are about to add or include specific information or items in a document or text. Example: "Please ensure that you are inserting the following details into the report: the date, the project name, and the team members involved."

✓ Grammatically correct

Science

Wiki

News & Media

Human-verified examples from authoritative sources

Exact Expressions

10 human-written examples

The GFP-specific shRNA in the pBSU6 vector was previously described [58], and the two NFAT5-specific shRNAs were done by inserting the following 21-nucleotide sequences complementary to NFAT5 mRNA in pBSU6: shNFAT5-1 (shN5-1), 5'-GGT CAA ACG ACG AGA TTG TGand'; and shNFAT5-3 (shN5-3), 5'-GGT CGA GCT GCG ATG CCC TCCC3'.

Plosone

The plasmids that express shRNA to knock down Bak and Bid were constructed by inserting the following sequences into the lentiviral vector pLKO.1.

BioMed Research International

The PIPE method was also used to create two mutants by inserting the following point mutations in the SitA23 306 expression construct: H64A and E203A+D278A.

Bioscience Reports

We used a mutated sequence by inserting the following oligonucleotides (Integrated DNA Technologies Inc).: sense, 5- CTAGTTTAACTCTTCCACGCCCGAGGGATCCA-3; and antisense, 5- AGCTTGGATCCCTCGGGCGTGGAAGAGTTAAa-3.

BioMed Research International

Sh-RNA plasmids used for targeted silencing of OLA1 (sh-OLA1) and the control non-targeting plasmid (sh-control) were made by inserting the following short-hairpin sequences into the pLVTHM vector (Addgene: #12247): 5′-CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTTG-3′ for sh-OLA1 and 5′-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3′ for sh-control.

Cell Death and Disease

The reporter plasmid pGL4-ERE-LUC was obtained by inserting the following two annealed oligonucleotides between the Xho I-Hind III sites of the multiple cloning site of the luciferase reporter vector pGL4-basic (Promega, Madison, WI): 5' TCG AGA GGT CAC AGT GAC CTA GGT CAC AGT GAC CTA GAT CTG GGC ATA TAA TGGand' and 5'-AGC TTC CAT TAT ATA CCC AGA TCT AGG TCA CTG TGA CCT AGG TCA CTG TGA CCTGA3'.

BMC Genomics

Human-verified similar examples from authoritative sources

Similar Expressions

50 human-written examples

They inserted the following text into the specific paragraph that addresses debt management: "Maintaining sustainable debt levels is the responsibility of the borrowing countries … " It is plainly obvious why this language is harmful and, given the situation in Greece, callous for the EU to even propose it.

The Guardian

(Spin off into a new series?) CBS Television Stations Division Picking up on the success of the Bush "subliminable" ad that flashed "-RATS" into an anti-Gore ad, we will insert the following messages into prime-time programming on each of our 35 television stations: YOU ARE GETTING SLEEPY.

The New York Times

Simply we insert the following part of Boolean algebra in Ontology based.

Human-centric Computing and Information Sciences

We insert the following data into the ROOT lookup table where ID is the fragment identifier, Name is the fragment name, S is the fragment size in number of tuples, and Host is the name of the server where the fragment is assigned to.

Journal of Cloud Computing

We inserted the following annealed oligonucleotides between the Bgl II/Hind III sites of either pENTR/pTER+ or pENTR/pSUPER+: For Asf1a: 5'GATCCCGTGAAGAATACGATCAAGTGTGTGCTGTCCACTTGATCGTATTCTTCACTTTTTGGAAA and 5'AGCTTTTCCAAAAAGTGAAGAATACGATCAAGTGGACAGCACACACTTGATCGTATTCTTCACGG, where the underlined sequence is specific for human Asf1a.

Plosone

Expert writing Tips

Best practice

When using "inserting the following", ensure that the information you are about to introduce is clearly and concisely presented to maintain readability.

Common error

Avoid using "inserting the following" when a more direct and active voice construction would be clearer. For example, instead of "The code was inserted by inserting the following...", try "We inserted the following code..."

Linguistic Context

The phrase "inserting the following" functions as a gerund phrase that introduces specific information. Ludwig's examples show its use across science, wiki, and news media, indicating that it is used to present specific information that will be added, included, or integrated into the text.

Expression frequency: Uncommon

Frequent in

Science

40%

Wiki

30%

News & Media

15%

Less common in

Encyclopedias

5%

Formal & Business

5%

Reference

5%

Ludwig's WRAP-UP

In summary, "inserting the following" is a grammatically correct phrase used to introduce specific information, such as code, data, or instructions. Ludwig's AI confirms its acceptability. While not exceedingly common, it is employed across scientific, wiki, and news contexts with a neutral to formal tone. When using this phrase, ensure clarity in the subsequent information. Common errors include overuse of passive voice. Alternatives include "adding the subsequent" or "including the ensuing", depending on the specific nuance desired.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

adding the subsequent

Replaces "following" with a synonym, focusing on the sequential aspect.

including the ensuing

Substitutes "following" with a word suggesting a natural consequence or result.

introducing the upcoming

Changes "following" to emphasize that the information is about to be presented.

providing the listed

Replaces "inserting" with "providing" to suggest a presentation of information.

adding the undermentioned

Uses a more formal synonym for "following", indicating information mentioned below.

incorporating the succeeding

Emphasizes a sequential addition, similar to "adding the subsequent".

integrating the below

A more concise way to indicate that information below is being integrated.

putting in the following

Uses a more informal verb to replace "inserting", keeping the rest of the phrase intact.

enclosing the attached

Suggests the inclusion of something physically attached or enclosed.

entering the forthcoming

Indicates that the information is about to come and is being entered or added.

FAQs

How can I use "inserting the following" in a sentence?

You can use "inserting the following" to introduce a list, a piece of code, or any specific information that you are adding into a text. For example, "The instructions require "inserting the following" code snippet."

What are some alternatives to "inserting the following"?

Alternatives include "adding the subsequent", "including the ensuing", or "introducing the upcoming", which all serve a similar purpose of indicating that you're about to provide more information. See more options "here".

Is it better to use "inserting the following" or "insert the following"?

"Inserting the following" is a gerund phrase, often used to describe an action in progress or as part of instructions. "Insert the following" is an imperative, directly instructing someone to add something. Choose the one that fits the context of your writing.

What kind of information is usually introduced by "inserting the following"?

Typically, "inserting the following" precedes specific, often technical, information such as code snippets, data points, configuration settings, or direct quotations that need to be added to a document or system.