following the specification

USAGE SUMMARY

The phrase "following the specification" is correct and usable in written English.
It can be used when referring to actions or processes that adhere to a set of guidelines or requirements outlined in a specification document. Example: "The team is currently working on the project, ensuring that all tasks are completed following the specification provided by the client."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

6 human-written examples

3' RACE was performed using RT-PCR product as template with two nested gene-specific sense primers, GPS1 (5'GCCCTandTCCAACGPS2GTAG3') and GPS2 (5'CAACCGTGAGTGTCCTAATCAG3'), following the specification of 3'RACE kit (Takara, Shiga, Japan).

Plosone

For this reason, a model validation process is carried out by an assessment of residuals, and also a model selection process by using information criteria and a likelihood ratio test following the specification by Davies (1987).

Latin American Economic Review

The WCDMA signal used in this paper is generated following the specification defined by 3GPP test model 3, for which 64 users (16-QAM) are multiplexed in dedicated physical data channel (DPDCH) to form the 3.84 Mc/s chip rate.

EURASIP Journal on Wireless Communications and Networking

A possible problem is the difficulty to recognize names not following the specification to a certain degree as well as the completeness and maintenance of a changing standard.

Bioinformatics

Because of the random intercept, represented by the quintile variable (Q1 to Q5), predicted rates by suburbs were clustered in groups following the specification of the model.

BMC Public Health

Following the specification on the photo emulsion bottle, set up a light above your flat black surface.

WikiHow

Human-verified similar examples from authoritative sources

Similar Expressions

53 human-written examples

The second bacteria made all the proteins and organelles in the so-called "synthetic cell," by following the specifications implicit in the structure of the inserted DNA.

The New York Times - Science

In European countries, the design of bridges is conducted following the specifications in the Eurocodes.

Journal of Constructional Steel Research

In addition to following the specifications above, please do not include any editing or graphic overlays – just a straight pitch from beginning to end.

TechCrunch

Probabilistic constraints of ultimate load limits and serviceability limits are defined following the specifications for structural steel buildings by AISC.

Journal of Constructional Steel Research

Panc1 cells were incubated in DMEM with 0.5 mM of AGuIX following the specifications below, and then irradiated.

Cancer Nanotechnology

Expert writing Tips

Best practice

When documenting a process, clearly state which specification you are "following" by referencing the document name or version number to avoid ambiguity.

Common error

Avoid vague references. Instead of just saying "following the specification", be specific about which section or requirement is being addressed to ensure clarity and accuracy.

Linguistic Context

The phrase "following the specification" functions as a prepositional phrase that modifies a verb, indicating the manner in which an action is performed. It specifies adherence to a set of predefined guidelines or requirements. Ludwig AI shows examples in science and news context.

Expression frequency: Uncommon

Frequent in

Science

70%

News & Media

20%

Formal & Business

10%

Less common in

Wiki

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

In summary, "following the specification" is a phrase used to indicate adherence to a specific set of guidelines or requirements. As confirmed by Ludwig AI, it's grammatically correct and commonly found in scientific and technical contexts. For more formal or varied expressions, alternatives like "in accordance with the specification" or "as per the specification" can be used. To ensure clarity in writing, always specify which specification is being followed. Overall, this phrase serves to communicate compliance and precision in various processes.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

in accordance with the specification

Replaces "following" with a more formal prepositional phrase, emphasizing compliance.

as per the specification

A concise alternative using "per" to denote acting according to the specification.

adhering to the specification

Uses a verb to emphasize sticking closely to the given details.

complying with the specification

Highlights the act of meeting the requirements laid out.

conforming to the specification

Focuses on aligning actions with the standards defined in the specification.

observing the specification

Emphasizes careful attention to and compliance with the specification.

meeting the specification

Indicates that the requirements of the specification are satisfied.

in line with the specification

Suggests actions are aligned or consistent with the specification.

pursuant to the specification

A formal option indicating action is taken as a result of the specification.

guided by the specification

Focuses on the specification as a source of guidance for action.

FAQs

How can I use "following the specification" in a sentence?

You can use "following the specification" to describe adhering to a set of guidelines. For example, "The engineers designed the product "following the specification" outlined in the project brief."

What are some alternatives to "following the specification"?

You can use alternatives like "in accordance with the specification", "as per the specification", or "adhering to the specification" depending on the context.

What is the difference between "following the specification" and "meeting the specification"?

"Following the specification" implies adhering to guidelines during a process, whereas "meeting the specification" indicates the end result satisfies the requirements.

Is it better to say "following the specification" or "following the specifications"?

Both are correct, but "following the specifications" is used when referring to multiple requirements or detailed instructions, while ""following the specification"" is suitable when there's a single, overarching document or standard.