avoid any repeat

USAGE SUMMARY

The phrase "avoid any repeat" is correct and usable in written English.
It can be used when advising someone to prevent a situation or action from happening again. Example: "To improve our workflow, we need to identify the issues and avoid any repeat of the same mistakes."

✓ Grammatically correct

News & Media

Science

Human-verified examples from authoritative sources

Exact Expressions

11 human-written examples

The state insists new monitoring equipment and extra training for the executioners will avoid any repeat tragedy.

The Guardian

The two parties are keen to avoid any repeat of 1987, when they were also in a coalition and failed to tackle an earlier Irish economic crisis.

The Economist

The Department for Transport is working with the airport authorities to try to put in place acceptable standards of security to avoid any repeat.

Independent

The fragile coalition government that Italy has had for just three months was the product of nearly two months of stalemate and fraught negotiations, and the president, Giorgio Napolitano, is understood to be desperate to avoid any repeat of the political paralysis.

The Guardian

Fabio Capello has warned his England players that they must make sacrifices off the pitch over the next three months to avoid any repeat of the recent controversies that have threatened to deflect the national team's attention from this summer's World Cup finals.

The Guardian - Sport

Underlining the authorities' determination to set a strong precedent and avoid any repeat of such wildcat action, Attorney General C ido Conde-Pumpido also insisted that, while the strike's leadership would most likely face the toughest sentencing, he would seek terms of at least three years for all those responsible for a chaotic weekend that affected about 650,000 passengers.

The New York Times

Human-verified similar examples from authoritative sources

Similar Expressions

49 human-written examples

Despite the strangeness of the scene at Comerica Park and the lengths the Tigers have taken to avoid any repeats of 2006, Leyland was in high spirits.

The New York Times - Sports

Probes were designed from within the 12 kb repeat units using PCR primers from conserved regions, which amplified a 2 kb fragment (Gor1AL- TGGATGATCTGTGCCAGGTA and Gor1AR- AAGGAGAAGTCCCACCCAGT) and a 1.6 kb fragment (Gor1BL- GGGTAGAGGAGGGTGAAAGG and Gor1BR- TTGGAACCATGCGAGTGATA, which were designed in "unique" sequence and avoided any Repeat Masked sequences.

BMC Genomics

The purpose of this design is to avoid any potentially repeated concept names.

BMC Genomics

Perhaps, but it's definitely in Mr. Altuzarra's interest to avoid any confusion, or repeated coincidences.

The New York Times

"I urge Fecofa (the Congolese football federation) and authorities in the DRC to thoroughly investigate this matter and ensure that measures put in place to avoid a repeat of any incidents are fully briefed with Caf and forestall any such occurrence". Local fans were unhappy after the home team, AS Vita Club, were defeated 1-0 by their rivals from Lubumbashi.

BBC

Expert writing Tips

Best practice

When using the phrase "avoid any repeat", clearly identify what specific situation or action you are trying to prevent from recurring. This provides context and ensures the intent is understood.

Common error

While generally acceptable, avoid overusing "avoid any repeat" in highly formal documents. Opt for more sophisticated synonyms like "preclude a recurrence" or "forestall a repetition" to enhance the tone.

Linguistic Context

The phrase "avoid any repeat" functions as a directive, urging the prevention of a recurrence. It's commonly used in contexts where a negative event has occurred and steps need to be taken to ensure it doesn't happen again. Ludwig AI confirms its usability in written English.

Expression frequency: Uncommon

Frequent in

News & Media

60%

Science

27%

Academia

13%

Less common in

Formal & Business

0%

Encyclopedias

0%

Wiki

0%

Ludwig's WRAP-UP

The phrase "avoid any repeat" is a grammatically sound and usable expression that directs actions to prevent the recurrence of a situation. Ludwig AI confirms its correctness and provides examples across various contexts. While it is generally versatile, it appears more frequently in news and media sources and less often in highly formal or business settings. For such formal contexts, synonyms like "prevent a recurrence" might be more appropriate. To enhance clarity, always specify what you aim to prevent when using this phrase. By understanding its nuances, you can effectively communicate the need to "avoid any repeat" in your writing.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

prevent a recurrence

This alternative emphasizes stopping something from happening again.

prevent it from happening again

This alternative is a more direct and explicit way of stating the intention to stop a future occurrence.

ensure it doesn't happen again

This emphasizes making certain that the event will not be repeated.

make sure it never happens again

This phrase adds a level of determination to prevent recurrence.

forestall a repetition

This suggests taking proactive measures to prevent a similar event.

preclude a replay

This alternative is more formal and emphasizes the impossibility of a recurrence.

avert a similar situation

This suggests steering away from a comparable set of circumstances.

head off a second instance

This implies intercepting or stopping a subsequent event before it occurs.

block its return

This alternative suggests actively impeding the return of an event or situation.

stop history from repeating itself

This phrase is broader and more metaphorical, suggesting preventing past events from recurring.

FAQs

How can I use "avoid any repeat" in a sentence?

You can use "avoid any repeat" to express the need to prevent a recurrence of something, such as "The company implemented new policies to "avoid any repeat" of the data breach".

What are some alternatives to "avoid any repeat"?

Alternatives include "prevent a recurrence", "ensure it doesn't happen again", or "forestall a repetition", depending on the context.

Is it grammatically correct to say "avoid any repeat"?

Yes, "avoid any repeat" is grammatically correct and commonly used. It effectively conveys the intention to prevent something from happening again.

What's the difference between "avoid any repeat" and "prevent a recurrence"?

"Avoid any repeat" is more general, while "prevent a recurrence" /s/prevent+a+recurrence is slightly more formal. Both express the same basic idea of stopping something from happening again, but the latter might be preferred in more formal contexts.