Sentence examples for as a negative tool from inspiring English sources

The phrase "as a negative tool" is correct and usable in written English
It can be used to describe something that is utilized in a detrimental or harmful way. Example: "Some people view social media as a negative tool for communication, believing it fosters misunderstandings and conflict."

Exact(1)

"This time, cricket is used as a negative tool.

Similar(59)

In this way, we remind literature on energy justice that subsidies are not always a negative tool as claimed by some scholars [3].

This shows that for nanoscale cutting with small cutting depth, as the tool edge radius is quite large compared to the cutting depth, the nanoscale cutting is more similar to the conventional grinding with a large negative tool rake angle.

The following paper treats the CF of the forestry and wood products industries as a negative CF. This paper presents a tool that accounts for the CO2-responsibility of consumers [32] in assessing the forestry and wood products industries' impact on climate protection.

The following paper treats the CF of the forestry and wood products industries as a negative CF. This paper presents a tool that accounts for the CO2-responsibility of consumers [ 32] in assessing the forestry and wood products industries' impact on climate protection.

A SC MO (SC: CCTCTTACCTCAGTTACAATTTATA) (Gene-tools, LLC) was used in parallel, as a negative control.

Try to look at the tools one uses in recovery (like 12-step programs) as something positive -- and not as a negative outcome or punishment for their addiction.

Don't take that as a negative.

Most would see it as a negative".

It is categorized as a negative emotion.

DMSO served as a negative control.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: