Sentence examples for as a negative tool from inspiring English sources

"This time, cricket is used as a negative tool.

In this way, we remind literature on energy justice that subsidies are not always a negative tool as claimed by some scholars [3].

This shows that for nanoscale cutting with small cutting depth, as the tool edge radius is quite large compared to the cutting depth, the nanoscale cutting is more similar to the conventional grinding with a large negative tool rake angle.

The following paper treats the CF of the forestry and wood products industries as a negative CF. This paper presents a tool that accounts for the CO2-responsibility of consumers [32] in assessing the forestry and wood products industries' impact on climate protection.

The following paper treats the CF of the forestry and wood products industries as a negative CF. This paper presents a tool that accounts for the CO2-responsibility of consumers [ 32] in assessing the forestry and wood products industries' impact on climate protection.

A SC MO (SC: CCTCTTACCTCAGTTACAATTTATA) (Gene-tools, LLC) was used in parallel, as a negative control.

Try to look at the tools one uses in recovery (like 12-step programs) as something positive -- and not as a negative outcome or punishment for their addiction.

Don't take that as a negative.

Most would see it as a negative".

It is categorized as a negative emotion.

DMSO served as a negative control.