as a negative tool

USAGE SUMMARY

The phrase "as a negative tool" is correct and usable in written English.
It can be used to describe something that is utilized in a detrimental or harmful way. Example: "Some people view social media as a negative tool for communication, believing it fosters misunderstandings and conflicts."

✓ Grammatically correct

News & Media

Science

Wiki

Human-verified examples from authoritative sources

Exact Expressions

1 human-written examples

"This time, cricket is used as a negative tool.

The New York Times

Human-verified similar examples from authoritative sources

Similar Expressions

59 human-written examples

In this way, we remind literature on energy justice that subsidies are not always a negative tool as claimed by some scholars [3].

Energy, Sustainability and Society

This shows that for nanoscale cutting with small cutting depth, as the tool edge radius is quite large compared to the cutting depth, the nanoscale cutting is more similar to the conventional grinding with a large negative tool rake angle.

Nanoscale Research Letters

The following paper treats the CF of the forestry and wood products industries as a negative CF. This paper presents a tool that accounts for the CO2-responsibility of consumers [32] in assessing the forestry and wood products industries' impact on climate protection.

Carbon Balance and Management

The following paper treats the CF of the forestry and wood products industries as a negative CF. This paper presents a tool that accounts for the CO2-responsibility of consumers [ 32] in assessing the forestry and wood products industries' impact on climate protection.

Carbon Balance and Management

A SC MO (SC: CCTCTTACCTCAGTTACAATTTATA) (Gene-tools, LLC) was used in parallel, as a negative control.

Human Molecular Genetics

Try to look at the tools one uses in recovery (like 12-step programs) as something positive -- and not as a negative outcome or punishment for their addiction.

Huffington Post

Don't take that as a negative.

The New York Times

Most would see it as a negative".

The New York Times - Sports

It is categorized as a negative emotion.

Huffington Post

DMSO served as a negative control.

Plosone

Expert writing Tips

Best practice

When using "as a negative tool", ensure the context clearly illustrates the detrimental or harmful application being described. Provide specific examples or explanations to support your assertion.

Common error

Avoid using "as a negative tool" without providing context. It's important to specify why something is considered a negative tool and what its adverse effects are. Vague statements can weaken your argument.

Linguistic Context

The phrase "as a negative tool" functions as a predicate nominative or appositive phrase, describing something's role or purpose in a detrimental manner. As evidenced by Ludwig, the phrase qualifies how an entity (e.g., cricket, subsidies) is employed, characterizing its application.

Expression frequency: Rare

Frequent in

News & Media

31%

Science

56%

Wiki

13%

Less common in

Formal & Business

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "as a negative tool" is deemed grammatically correct by Ludwig and usable in English, albeit infrequently. It describes something employed in a detrimental or harmful manner. While its usage is rare, it appears in news, scientific, and wiki contexts, suggesting a neutral to formal register. Key alternatives include "as a detrimental instrument" and "as a harmful mechanism". The phrase should be used with specific context to avoid overgeneralization and enhance clarity, thereby bolstering its impact. Ludwig provides valuable examples showcasing its proper application.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

as a detrimental instrument

Replaces "negative" with "detrimental" and "tool" with "instrument", emphasizing the harmful nature of the means.

as a harmful mechanism

Substitutes "negative" with "harmful" and "tool" with "mechanism", highlighting the damaging effect of the process.

as a destructive device

Replaces "negative" with "destructive" and "tool" with "device", focusing on the ruinous aspect of the implement.

as an adverse means

Replaces "negative" with "adverse" and "tool" with "means", indicating an unfavorable method or approach.

as a counterproductive method

Replaces the entire phrase with a description of the tool's effect, emphasizing its ineffectiveness and harm.

as an impediment

Simplifies the phrase to a single word, indicating something that hinders or obstructs.

as a source of negativity

Shifts the focus from the tool itself to its effect, highlighting that it produces negative outcomes.

as a liability

Replaces the phrase with a term indicating a disadvantage or drawback.

as a disservice

Highlights the harm done by something, framing it as an unfavorable action.

as a weakness

Replaces the phrase with a general term for a flaw or deficiency.

FAQs

How can I use "as a negative tool" in a sentence?

You can use "as a negative tool" to describe something that is used in a detrimental or harmful way. For example, "Some people view social media "as a negative tool" for communication, believing it fosters misunderstandings and conflicts."

What are some alternatives to saying "as a negative tool"?

Alternatives include "as a detrimental instrument", "as a harmful mechanism", or "as a destructive device", depending on the specific nuance you wish to convey.

When is it appropriate to use the phrase "as a negative tool"?

It's appropriate when you want to emphasize that something, be it a technology, a policy, or a strategy, is being used in a way that produces undesirable or harmful results. Make sure to provide context so the negative impact is clear.

What's the difference between "as a negative tool" and "as a harmful influence"?

"As a negative tool" implies an active application with detrimental effects, while "as a harmful influence" suggests a more passive or indirect effect. A tool is something actively wielded, while an influence can be more subtle and pervasive.