amplified form

USAGE SUMMARY

The phrase "amplified form" is correct and usable in written English.
It can be used when referring to a version of something that has been enhanced or made more intense, often in a technical or artistic context. Example: "The artist presented an amplified form of the original piece, adding layers of sound and visual effects."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

7 human-written examples

The putative PHA synthase (phaC Bs ), β-ketothiolase (phaA Bs ), acetoacetyl-CoA redutase (phaB Bs ) and PHA synthesis regulator (phaR Bs ) genes were amplified form the chromosomal DNA of Burkholderia sp. using primer pairs І, ІІ and ІІІ respectively (Table 2).

AMB Express

MEL-18 and RYBP full-length cDNA fused to a C-terminal 2xFlag was amplified form pCBA-2xFlag vector using universal forward (CTCGAGGCGAGAGAGGATCCACCATG) and reverse (GCGGCCGCCTTTCACTTATCGTCGTCATCCTT) primers and cloned into pCAG vector (Elderkin et al., 2007 ).

Cell

The Vineyard showcases, in amplified form, a style of prayer that has become widespread over the past four dec­ades.

The New York Times - Books

As the tools and algorithms become more sophisticated and our online profiles more refined, the Internet will act increasingly as an incredibly sensitive feedback loop, constantly playing back to us, in amplified form, our existing preferences".

The New Yorker

Published in amplified form in 1913, his paper contained the first comprehensive theory of metamorphic rocks and proved to be singularly fruitful for advances in their study.

Encyclopedia Britannica

That is a good one which that has actually been retained, in amplified form, in our manifesto.The Economist: You often talk about the growth of third-party votes and the long-term trend in that direction.

The Economist

Human-verified similar examples from authoritative sources

Similar Expressions

53 human-written examples

Another feature is that they require the DNA to be clonally amplified forming a consensus template prior to sequencing.

Biotechnology journal

Specific primers were designed to amplify form 1 to 1,5 kb fragments of Hd3a, RFT1, Ehd1 or Hd1 (Additional file 1: Table S1).

BMC Genomics

Explains Kenneth Lapatin, associate curator of antiquities at J. Paul Getty Museum, Blakee was amazed by honey's transformations... how it can distort and amplify forms, highlight physical perfection, engender repulsion, and suggest both immortality and death".

Vice

While the SOF was derived to be highly insensitive to channel distortion in (10), the SOF image obtained when a deep fade can be significantly distorted by the additive noise components present, which will be amplified when forming the SOF from the SCF.

EURASIP Journal on Wireless Communications and Networking

Most of these differences could be accounted for by examining the homeologous linkage groups in rainbow trout; simply, genotyping efforts in both species might have amplified alternative forms of a duplicated locus.

G3: Genes, Genomes, Genetics

Expert writing Tips

Best practice

Use "amplified form" to denote a version that's been significantly enhanced or intensified. For clarity, ensure the context makes clear what the original form is and how it has been amplified.

Common error

Avoid using "amplified form" when the change is minor or subtle. This phrase implies a substantial increase or enhancement, so ensure it accurately reflects the magnitude of the change.

Linguistic Context

The phrase "amplified form" functions as a descriptive term, typically modifying a noun to indicate that it is a more intense, enhanced, or exaggerated version of something else. As Ludwig AI suggests, the phrase is grammatically correct and usable in various contexts.

Expression frequency: Common

Frequent in

Science

40%

News & Media

40%

Encyclopedias

8%

Less common in

Wiki

4%

Formal & Business

4%

Social Media

0%

Ludwig's WRAP-UP

In summary, the phrase "amplified form" is a grammatically sound and frequently used expression denoting a significant enhancement or intensification. Ludwig AI confirms its correctness and usability across diverse writing scenarios. It finds common usage in scientific and news contexts, indicating a versatile application range. When using this expression, writers should ensure that the degree of amplification is substantial and clearly defined. Alternative phrases such as "enhanced version" or "expanded version" can be considered to add diversity to your writing.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

enhanced version

Focuses on the improvement or augmentation of something.

expanded version

Highlights the increase in size or scope.

intensified version

Emphasizes the increase in strength or degree.

exaggerated form

Suggests an overstatement or distortion of the original.

magnified version

Implies making something appear larger or more significant.

boosted form

Indicates an increase in power or effectiveness.

augmented version

Focuses on adding to something to improve it.

reinforced version

Emphasizes strengthening or supporting something.

developed version

Implies a more advanced or evolved stage.

refined version

Suggests improvement through careful adjustment or alteration.

FAQs

How can I use "amplified form" in a sentence?

You can use "amplified form" to describe something that has been enhanced or intensified. For example, "The internet has presented us with an "amplified form" of communication."

What are some alternatives to "amplified form"?

Alternatives include "enhanced version", "expanded version", or "intensified version", depending on the specific nuance you wish to convey.

When is it appropriate to use "amplified form" instead of "enhanced version"?

"Amplified form" is best used when the increase or enhancement is significant or substantial, while "enhanced version" can be used for more general improvements.

Is "amplified form" considered formal or informal language?

"Amplified form" is generally considered neutral to formal language, suitable for academic, professional, and news contexts.