a standard quantity of

USAGE SUMMARY

The phrase "a standard quantity of" is correct and usable in written English.
It can be used when referring to a specific, commonly accepted amount of something, often in contexts like measurements, recipes, or scientific discussions. Example: "In the recipe, you will need a standard quantity of flour to ensure the cake rises properly."

✓ Grammatically correct

Science

News & Media

Encyclopedias

Wiki

Human-verified examples from authoritative sources

Exact Expressions

5 human-written examples

At Proton Energy, a Connecticut company that builds the electrolyzing machines that use current to produce hydrogen, Walter Schroeder, president and chief executive, laid out the problem in terms of dollars per million B.T.U.'s, a standard quantity of heat in the fuel business.

The New York Times

A standard quantity of electricity generation (Q_{text{E}}) is set to 2165 GWh such that all RES produce the same average annual output.

Renewables: Wind, Water, and Solar

A standard quantity of 3H-thymidine-labeled Enterococcus faecalis (3.70 × 104 cpm, 2.0 × 107 colony-forming units) was used to inoculate the mesiobuccal canals of 50 extracted mandibular molars.

Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology

Of the remaining 44 teeth, 22 then were instrumented with GT and Profile (Dentsply/Tulsa Dental Co, Tulsa, Okla) instruments to apical size #35 (group 1) and 22 teeth with Pow-R instruments (Moyco/Union Broach, York, Pa) to apical size #50 (group 2), in the presence of a standard quantity of phosphate-buffered saline solution placed in the canal.

Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology

Indeed, there was a significant, negative relationship between the time it took to capture and consume a standard quantity of shrimp and both maternal size (Fig. 1; slope  = −0.14 ± s.e. 0.048) and tadpole size (Fig. 2; slope  = −0.217 ± s.e. 0.031).

Plosone

Human-verified similar examples from authoritative sources

Similar Expressions

55 human-written examples

Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA.

Journal of Virological Methods

Standard quantities of 2X PCR Master Mix and SuperScript III RT/Platinum Taq Mix were added to the mixture reaction containing 0.8 µM of each primers (GRswH1-349Fw GAGCTAAGAGAGCAATTGTAGATGGATGGTGAATGTandTGGATGGTGAATG) and 0.2 µM of the probe (GRswH1-538Probe TTGCTGAGCTTTGGGTATGA [5']Fam [3']BHQ-1).

Plosone

Standard quantities of intact total RNA or mRNA were reverse transcribed and subjected to Q-PCR.

Breast Cancer Research

Individual sample differences were calculated based on the ratio of standard quantities of gli1 and gapdh transcripts determined by the standard curve method.

BMC Cancer

A standard curve between quantity of RL7-11 and size of OSZ could be obtained based on this method.

AMB Express

Due to the routine with which hyperfine structure measurements are done, a tool for keeping the necessary information together, performing checks online with the experiment and deriving standard quantities is of great help.

Computer Physics Communications

Expert writing Tips

Best practice

When using "a standard quantity of", ensure the standard being referenced is clearly defined or commonly understood within the context to avoid ambiguity.

Common error

Avoid assuming that "a standard quantity of" is universally known. Always provide context or clarify the standard, especially when communicating with a diverse audience.

Linguistic Context

The phrase "a standard quantity of" functions as a determiner phrase specifying a particular amount of something. It highlights that the quantity being referenced is not arbitrary but conforms to an established norm or definition. Ludwig AI confirms its usability and correctness.

Expression frequency: Common

Frequent in

Science

60%

News & Media

20%

Encyclopedias

10%

Less common in

Wiki

10%

Formal & Business

0%

Social Media

0%

Ludwig's WRAP-UP

In summary, the phrase "a standard quantity of" is a grammatically correct and commonly used expression, primarily found in scientific and technical contexts. As Ludwig AI confirms, it is suitable for referring to specific, established amounts of something. While the phrase is considered correct, it's important to define or provide context for the 'standard' being referenced, especially for diverse audiences. Alternatives like "a typical amount of" or "a specified quantity of" can be used depending on the desired level of precision. The phrase's prevalence in scientific and news media underscores its role in ensuring clarity and consistency in various applications.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

a typical amount of

Replaces "standard" with "typical", emphasizing commonness rather than a defined norm.

a usual quantity of

Similar to "typical amount", highlighting what is normally expected.

a set quantity of

Emphasizes that the quantity is predetermined or fixed.

a fixed amount of

Focuses on the immutability of the quantity.

a specified quantity of

Highlights that the quantity has been explicitly stated.

a defined quantity of

Stresses the clarity and precision of the quantity.

a prescribed quantity of

Implies that the quantity is recommended or required by a rule or authority.

a conventional amount of

Suggests the amount is agreed upon or widely accepted.

an established quantity of

Indicates the quantity is recognized and accepted through long use.

a regulated quantity of

Suggests the quantity is controlled by rules or laws.

FAQs

How do you use "a standard quantity of" in a sentence?

You can use "a standard quantity of" to refer to a commonly accepted or predetermined amount of something. For example, "The experiment requires "a standard quantity of" reagent."

What's the difference between "a standard quantity of" and "a typical quantity of"?

"A standard quantity of" implies a more precise or officially recognized amount, while "a typical quantity of" suggests a common or usual amount that may vary slightly.

Which is correct: "standard quantity" or "quantity standard"?

"Standard quantity" is the correct order. The adjective "standard" modifies the noun "quantity". "Quantity standard" is not a commonly used or grammatically correct phrase.

What can I say instead of "a standard quantity of"?

You can use alternatives like "a typical amount of", "a fixed quantity of", or "a specified amount of" depending on the context.