Sentence examples for Red cassette from inspiring English sources

The straightforward identification of carriers together with our simple cloning scheme should easily facilitate the insertion of the STOP-dsRed cassette into the gene of choice.

In step 1, we aimed to insert a STOP-3xP3-dsRed cassette flanked by two attP sites using a donor plasmid.

Primers used to amplify the homology arms have a 5′ BsmBI site enabling Golden Gate assembly with the STOP-dsRed cassette.

We exchanged the STOP-dsRed cassette with a short 2xTY1-V5 exon, a FRT-2xTY1-FRT-V5 conditional exon, and a large GFP-3xFLAG exon from Venken et al. (2011).

To test the efficiency of inserting our STOP-dsRed cassette, we designed three donor constructs targeting different regions in the salm gene: the first, deleting parts of exon 1; the second, inserting the cassette into intron 1; and the third, deleting exon 3.

Although Act5C-Cas9 expressisnots not restricted to the germline, injections of the donor vector together with two verified sgRNAs led to a targeting efficiency of 2%14%% of fertile G0 flies for the incorporation of the large STOP-dsRed cassette, even for the bent locus on the heterochromatic fourth chromosome.

Each exchange vector contains a PGK/EM7- neo R cassette flanked by FRT sites.

bNucleotides in boldface type indicate priming sites within mutagenesis template plasmid pEP-KanS for amplification of Kan R cassette.

Recombination was performed by amplifying a mCitrine-Kan(R) cassette using primers that contained 50bp of homology flanking the start codon: pdgfrb_HA1_mCitrine, TTTGGCTTTGAGGCGAATCAGTCATGTTGTTTTCTCTCCGTCTGCAGTGTACCATGGTGAGCAAGGGCGAGGAG and pdgfrb_HA2_Kan(R), TGGATGCGGCTGATGGTCGAACTCTTCATGCTTTCTTCTAGAGCAGGACATCAGAAGAACTCGTCAAGAAGGCG.

These fragments were inserted on either side of a neo r cassette within a pPN targeting vector to produce the final targeting construct (Fig. 1A).

The mutant pVP19C NEshowed37BamHIhowedigestionigestion patterns similar to that of wild-type 17 37 BAC, while the pVP19C NESm/Kan/17-37BAC presented band variations approximately 6 8 kb fragments due to the insertion of a Kan R cassette.