Sentence examples for zero dilution from inspiring English sources

At zero dilution (21% intake oxygen), soot appears nearly simultaneously with PAH, while at higher dilution (12.7% or 9.5% intake oxygen), soot formation is delayed by hundreds of microseconds to a millisecond or more.

After a one in two dilution, all ten of these samples amplified the internal control satisfactorily.

After a one in two dilution, we observed internal control amplification and target DNA amplification for four samples.

One thousand dilution of the above-mentioned PCR was used to amplify a nested PCR fragment with a 5ʹ RACE inner primer and a gene-specific primer (5ʹCTCCTATCTCCAAGGGCGCTAT 3ʹ).

An internal amplification control which was coamplified with targets revealed PCR inhibition in five samples which was resolved following a one in ten dilution.

A single compartment IAQ model, modified by the authors, was used to test for the variation in the above two dilution modes and to test the performance sensitivity.

Differences between examiners were never greater than one dilution and the mean of both dilutions was taken.

The standard curve was generated using a tenfold dilution series over three dilution points that were measured in triplicate.

The standard curves were constructed from five dilution points, each as three parallel determinations.

Each sample was read in duplicate and measured against the mean of two dilution rows.

The PAM copy numbers were determined as two dilution points, each as three parallel determinations for each sample.