Sentence examples for you set left from inspiring English sources

If you need some more adjusting to your tab, simply drag the tab you set left or right along the ruler.

The opening Gesualdo set left a listener with strong doubts about the enterprise.

Primer sequences: Control set (Left -TCCTCAAGTTTCCGCACAGT Right- GGCTGCCCATTTTGTATTGA, Product size - 82), Peptide 5 set (Left –TCAGTGGTCTTGGTGGCTTT, Right – CCACCATAGAGGCCAGAACT, Product size – 208), Peptide 3 set (Left – GCAGCAACCCCAACAAAC, Right – CCCTGCCCTCACCATATTCT, Product size – 75), Peptide 4 set (Left – CATTGGGGTGGGAAAAAGTT, Right – GGCCATTGTTGCACAGAGAG, Product size – 187).

The high-tariff weeds out the chunky cruise-ship set, leaving a fairly sophisticated crowd.

Thirty respondents were excluded from the modelling data set, leaving 199.

These patients were removed from the data set leaving 87 patients for further analysis.

After it's set, leave it for a few hours to rest.

Teeth like a mahjong set left in the rain.

Figures  5 and 6 (3,0 T MRI conventional coil set, left leg and right leg).

The pure smile that radiates from the face of a dazzling toddler in the right coffee shop can in an instant set you left you up and set you right back on course.

The good news, though, is that they've been repackaged as one set, leaving you to find Chris Bell's I am the Cosmos, the only album by the group's original guitarist who died in a car accident in 1978.