Sentence examples for yielding bands from inspiring English sources

The genomic PCR yielded a 7.5-kb band from the wild-type; thus, lines yielding bands smaller than 7.5 kb were analyzed further.

PCR-amplification of the promoter region using Primer F: TCGTTCACCACGGTAGATAGACTCAT and Primer R: CCCACATCTTCTCCTTGCATAATCC, followed by digestion with Mae III (PCR-RFLP analysis), yielded a 291 bp-band and a 79-bp band for the Rf17 allele, while yielding bands of 192 bp, 99 bp and 79 bp for the rf17 allele (Fig. 1).

In addition, several works involving promoter hypermethylation analysis using DNA extracted from tumor samples showed that MSP detection of both methylated and unmethylated alleles in the same sample was possible, yielding bands with similar intensities [ 8, 41, 42].

This Multiplex PCR is a simple and convenient method performed with primers specific for highly conserved regions in the urease gene of Ureaplasma spp., the 140-kDa adhesion protein gene of M. genitalium, and the 16S rRNA gene of M. hominis, yielding bands of 403 – 448 bp, 282 bp, and 334 bp, respectively [ 16].

Amplicons from these reactions would be electrophoresed and scored based on band size, with SINE-containing loci (filled sites) yielding larger bands than those lacking the SINE insertion (empty sites).

The core is mechanized to obtain two yielding lateral bands which are connected by several equidistant stabilizing bridges.

Table 2 Primer sequences and restriction enzymes of STS and CAPS markers yielding polymorphic bands for tea germplasm Marker* Forward primer Reverse primer Size (bp) Annealing temp.

Only PCR reactions yielding single bands were transferred to printing plates, at a final concentration of 150 ng/ μL in PRONTO Universal Spotting Buffer Corning Life Sciencess).

Crude chloroform extract (7.2 g) was dissolved in dichloromethane : methanol (2 : 1) and subjected to PTLC with mobile phase ethyl acetate : methanol (10 : 1) yielding 3 bands.

(B ) The mRNAs encoding consecutive AAA codons result in discrete length toeprint signatures, yielding specific bands corresponding to the full-length message on our toeprints.

VNTR loci AFPM-1, -4, -5, -6 and -7 were successfully amplified from the strains included in the initial analysis of Iranian and Australian isolates, yielding single bands in the expected size range (Table  1).