Sentence examples for would be signals from inspiring English sources
"Nobody had predicted that there would be signals of this type of transport from a scanning tunneling microscope, so it came as a bit of a surprise," said Bernevig.
They would be signals of general alarm.
If the IME-EF4 has the protruding cohesive end situation according to cases 1, then there would be signals after either the terminal sequence GAGATTCGTTTAAGCGAAAG, ATTTTTTGAAGAAACTAATA, or both of them in the terminal run-off sequencing result.
Their downfall would be signaled elsewhere.
Detection of the virus would be signalled by a color change to blue.
"All of these Irish tugboat captains probably knew the service staff, and they would be signaling to them, 'Hi, I'm coming by!' But they would be signaling with these huge horns!
This understanding will demand tough choices – a successful deal would be signaled by complaints from hardliners on all sides.
During the battle, Joan is hit in the breast by an arrow its flight through the air would be signalled by a whizzing sound cue.
And what they called weirdness would be signaled through exotic means, like a lower-case I made with four vertical dots.
By taking the meeting, the campaign would be signaling an interest in whatever the foreign government might have to offer in the future.
The Japanese complained that the international community would be signaling "rogue states" that it was not serious about cracking down on germ weapons if it abandoned the effort to craft a new accord.
