Your English writing platform
Discover LudwigSimilar(60)
PCR was then performed using a primer with the adaptor sequence and primers within both the terminal coding exon of hnRNPA2/B1 (A2B15'1: TTTGGTGGTAGCAGGAACAT, A2B15'2: TGGAGGAAACTATGGTCCAG) and within predicted portions of the 3' UTR (A2B15'3: TTGGTTCCTTCAGTGGTGTT, A2B15'4: TGCTGCCACAAAGACTGTAA).
In such systems, the fast groundwater flow in localized karst conduits seems to coexist with a slower flow within other portions of the aquifer.
Careful assessment is required particularly within dependent portions of the pericardial sac.
We show that oxidized DNA and lipids are concentrated within active portions of the lesions.
This approach exploits the high degree of sequence conservation and general synteny within discrete portions of chloroplast genome.
The average recombination rate within genomic scaffolds was about three times greater than the estimated rate within unmapped portions of the genome.
Prior to the wildfire, specific yield was measured at 0.10 m depth increments through nine peat cores along the transect within both the drained and undrained portions of the peatland.
Brain scans of people laughing suggest that Duchenne laughter, as it is now called, originates within the limbic system, where fight-or-flight decisions are made, and within portions of the brain stem.
This species also is offered special legal protection within portions of its geographic range.
Our results indicate that Everglades restoration will provide the greatest benefits to native slough vegetation in Arthur R. Marshall Loxahatchee National Wildlife National Refuge (LNWR), Water Conservation Area (WCA) 3B, and Everglades National Park, and may degrade slough conditions within portions of WCA 2 and WCA 3A.
Their primary function is to plan and regulate land use and development within the unincorporated portions of Santa Clara County.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com