Sentence examples similar to with the sequence reversed from inspiring English sources

Similar(60)

The surface of the chip was then regenerated using 25 mM NaOH and the injection process was repeated, but with the antibody injection sequence reversed.

DTA files were submitted to Mascot (version 2.2.04, Matrix Science, Boston, MA) and searched against a Homo sapiens protein database downloaded from SwissProt concatenated with the sequence-reversed version of each entry (download March 2009, 20336 forward entries).

At the corresponding genomic locus a miRNA was predicted within our dataset but with the miRNA and miRNA* sequences reversed compared to the current miRBase entry.

An identical process was performed in parallel using the unmutated wildtype HA gene to generate unmutated viruses in order to quantify the error rates associated with sequencing, reverse transcription, and virus growth (these are the DNA and virus samples in Figure 1).

The same is repeated with the background/long motif sequence reverse complemented and the minimum of the KL divergences is taken.

The self-designed primers for BSP in the promoter were as follows: forward primer (23 nt) at the site of 447 469 bp with the sequence 5'TandGGGAGTTTGTTTTGGTATT3', and reverse primer (25 nt) at the site of 1022 1046 bp with the sequence 5'TTATACTCCAACTTATACCCCAAAA3'.

Human PAR2-activating peptide with the sequence trans-cinnamoyl-LIGRLO-NH2 (tcAP) and the reverse peptide with the sequence trans-cinnamoyl-OLRGIL-NH2 (tcRP) were synthesized at the University of Calgary (Peptide Synthesis Facility, Dr. D. McMaster, Calgary, Canada; http://www.ucalgary.ca/peptides/) and used at a concentration of 10−4 M as described previously [ 8].

Treating cancer cells with the reverse sequence, or even simultaneously, was either antagonistic or, at best, additive, and the same patterns were seen here with letrozole.

However, there was a decrease in the AUC of ifosfamide in the schedule of docetaxel→ifosfamide compared with the reverse sequence (Schrijvers et al, 2000).

A Spiegelmer® with the reverse sequence (revNOX-S93), also PEGylated at the 5′-end, served as a control for the specificity of NOX-S93′s actions.

In this study, the SN-38 AUC was 40% lower when irinotecan preceded 5-FU administration compared with the reverse sequence.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: