Sentence examples for with templates of from inspiring English sources

This is supported by the fact that while Ironclad will provide users with templates of common legal documents, the service also has a plan that lets companies import documents from their own lawyer.

Cr/Au (15-nm Cr and 50-nm Au) were fabricated on Al2O3 layers by thermal evaporation with templates of 150 × 150 μm2 in area as the top electrodes.

A total of four surgeons (three senior and one junior) fitted these true frontal views with templates of a collared femoral stem (Symbol®, Dedienne Santé, Mauguio, France) also printed with magnification of 115%.

Degenerate PCR reactions were done with templates of cDNA extracted from samples of 3 days of ABA treatment.

Focusing on a female voice among male voices would require comparison with an F0 range and with templates of spectral envelopes.

The region upstream to the miR-375 gene (putative miR-375 promoter region) was generated by PCR using primers 5' - GAAGATCTTGAGGTACATCGCAGAGGCCAG - 3' (top) and 5' - CATGCCATGGGGGCCGGAGCGGAAGACCC - 3' (bottom) with template of genomic DNA.

The results have shown that PCR amplification was successful only with template of DNA extracted by using TCM-CTAB.

The front-end was developed using Play Framework 2, a Model-View-Controller framework allowing code to be written in Java or Scala, with templating of HTML pages using Scala templates.

Compared to other fields of life sciences, forensic DNA analysis is confronted with template of low copy number, highly-degraded and contaminated samples, the need for high accuracy and reproducibility, as well as time and cost considerations.

Table 3 reports the effect of filler loading of MCM-T (with template) on the mechanical properties of the composites.

The "Grey's Anatomy" writers must have a folder somewhere filled with templates for certain types of episodes.