Your English writing platform
Free sign upSuggestions(1)
Exact(3)
The region upstream to the miR-375 gene (putative miR-375 promoter region) was generated by PCR using primers 5' - GAAGATCTTGAGGTACATCGCAGAGGCCAG - 3' (top) and 5' - CATGCCATGGGGGCCGGAGCGGAAGACCC - 3' (bottom) with template of genomic DNA.
The results have shown that PCR amplification was successful only with template of DNA extracted by using TCM-CTAB.
Compared to other fields of life sciences, forensic DNA analysis is confronted with template of low copy number, highly-degraded and contaminated samples, the need for high accuracy and reproducibility, as well as time and cost considerations.
Similar(57)
Table 3 reports the effect of filler loading of MCM-T (with template) on the mechanical properties of the composites.
Cr/Au (15-nm Cr and 50-nm Au) were fabricated on Al2O3 layers by thermal evaporation with templates of 150 × 150 μm2 in area as the top electrodes.
This is supported by the fact that while Ironclad will provide users with templates of common legal documents, the service also has a plan that lets companies import documents from their own lawyer.
A total of four surgeons (three senior and one junior) fitted these true frontal views with templates of a collared femoral stem (Symbol®, Dedienne Santé, Mauguio, France) also printed with magnification of 115%.
Degenerate PCR reactions were done with templates of cDNA extracted from samples of 3 days of ABA treatment.
Focusing on a female voice among male voices would require comparison with an F0 range and with templates of spectral envelopes.
The front-end was developed using Play Framework 2, a Model-View-Controller framework allowing code to be written in Java or Scala, with templating of HTML pages using Scala templates.
The results show that mesoporous carbon with template size of 50 nm has the largest BET surface area (2125 m2125.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com