Sentence examples for with a common reverse from inspiring English sources

They were paired with a common reverse primer.

Two different forward primers along with a common reverse one are used into separated reactions mixes from the same RNA preparation.

Forward primers, specific for each of the 5' untranslated exons were designed, and used in combination with a common reverse primer in exon 2 (schematically shown in Figure 5A).

The paralogue specific primer was 5′-TGCTTTGCTCCTCCTGCA-3′ or 5′-TGCTTTGCTCCTCCTGCG-3′, with a common reverse primer 5′-AGTTGCTCACATATGAGAGC-3′.

To amplify the different mef2ca isoforms specific forward primers spanning exon-exon junctions were used with a common reverse primer (Fig. S6B).

Primers representing previously annotated (5' GTGAGGAGGTTTTCTTGGAAG 3') and novel (5' CTTCTAGGGAATTGCGACTG 3') exons were used with a common reverse primer (5' CTGGGAAATACATCAGCTGG 3') to amplify products by RT-PCR followed by visualisation on an agarose gel and sequencing.

Two forward SNP allele-specific primers labelled with different fluorescent dyes for each SNP-STR marker were designed with the ARMS, and a common reverse primer was designed near the 3′ region of STR.

PCRs were performed with five distinct forward primers and a common reverse primer, resulting in the generation of five successive deletion constructs (-488 to +30, -375 to +30, -285 to +30, -167 to +30, and -65 to +30 bp).

Each SNP was amplified with two forward allele-specific primers and a common reverse primer.

For all the forward primers a common reverse primer was used, with the sequence 5′-ATA CCA CAG TGA ACA TAA TTG TGC ATA CAT-3′.

DNA was amplified with normal primer (NP) or mutation specific forward primers (ASO) and a common reverse primer.