The plant items give the process requirement whilst not specifying the heating or cooling medium.
Shorter timeframes (e.g., 3 months) are difficult to relate, whilst studies specifying no timeframe lack useful case definition.
The degrees of D.Litt., DSc, DEng, LL.D. and D.Mus., whilst having regulations specifying the grounds for award, are most often conferred as honorary degrees (in honoris causa).
The KR-A probe (aaggtggttggcccacaaatatgaatcggtag) recognised the nucleotide sequence specifying RWLAHKYESV, whilst the KR-B probe (cgagcatctggtttctgcccatggtgtccggc) recognised the nucleotide sequence specifying EHLVSAHGVR.
However, in general, existing workflow tools do not incorporate optimization algorithms, and thus whilst users can specify simulation pipelines, they need to invoke the workflow as a stand-alone computation within an external optimization tool.
However, in general, existing workflow tools do not incorporate optimization algorithms, and thus whilst users can specify complex computational and data manipulation pipelines, they need to invoke the workflow as a stand-alone computation within an external optimization tool.
For instance, Orkneyinga saga states as much; whilst Morkinskinna further specifies that Lagmann fled southwards and out to sea, as Magnús' fleet advanced, only to be captured and kept in the Norwegian king's company for some time afterwards.
Again, as the survey becomes more intensive, so the precision with which such specifications are given increases; thus in a semi-detailed survey a need for drainage might be specified, whilst in a detailed survey the nature and costs of drainage works would be given.
Most reserve-selection algorithms minimise the cost of the reserve system whilst aiming to meet specified biodiversity objectives.
The flux drift must be below the specified limit whilst the device satisfies other stringent specifications such as, 500 V galvanic isolation, 14-bit ENOB and environment magnetic field tolerance up to 10 mT.
