Your English writing platform
Free sign upSuggestions(1)
Exact(1)
For the rest of this paper, scalar entities are represented in italic, vector entities in bold, while underlined variables represent matrices [11].
Similar(59)
(Note: the top areas designate up-regulated genes, while the underlined (bold) one (bottom) signify down-regulated genes).
Edit the document, inserting or deleting letters, words, punctuation, etc. Inserted characters will be highlighted and underlined, while deleted characters will be highlighted and struck horizontally through the middle.
Q. Microsoft Word 2000 keeps turning Web addresses into underlined hyperlinks while I am in the process of typing them.
This paper ends by proposing steps and measures that should be undertaken in preparing Programme Assessment Plan, which tacitly inform the learning processes that should be undertaken in achieving its underlined outcomes, while at the same time contributing towards continuous quality improvement on part of the programme itself.
He noted that while some Web page conventions, like colored, underlined hyperlinks to other Web sites, are quickly understood by most new users, other inconsistencies in design and layout may make the Web hard to grasp.
In fact, in the (L/I/V GxxxSQ motif, the underlined portion is almost invariant, while the last two residues vary in only 15 of 155 elements (SP, SH, NQ, PA, AQ, VQ).
The underlined portions of the spoligotype must match exactly while the portions not underlined can take any value.
The upstream primer (5' TGCTGAAAGAAAATACCAGA 3') spanned an endogenous XbaI site, while the downstream primer (5' GC TCTAGAGAAAAAGCAGTTTGGGTACT 3') introduced another (underlined sequence).
While she was taking in German (indicated with an underlined in the text that follows), she would smoothly move to speak in Luxembourgish (indicated in bold italics), which is often the langauge of communication between students in Luxembourg.
The underlined sequence belongs to the T-DNA insert, while the non-underlined sequence belongs to the target gene and identifies the insertion site.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com