Sentence examples for while downstream from inspiring English sources

"Competition in physical mail" – that is competition for profits – "happens upstream", while "downstream delivery of physical mail" – that is, the actual work – "has the characteristics of a monopoly".

As a consequence, scarcity reappeared just years after each project was finished, while downstream the Gav-Khouni marsh faced a reduced flow inadequate to maintain aquatic habitats.

Tata then cut 1,200 jobs in October at sites in Scunthorpe, north Lincolnshire and Scotland, while downstream producer Caparo Industries also partly went into administration days later.

Upstream samples yielded significant (P<0.05) C. dubia toxicity and reproduction impairments, while downstream samples only yielded reproduction impairments.

The dam will provide upstream Tajikistan with hydropower, while downstream countries fear it could negatively impact their irrigated agriculture.

Forward primer (ACGTCATATGAATCATTTTATAGACGTTGAGATTCC) hybridized to a sequence upstream of comQ contained a NdeI site while downstream comX was amplified by reverse primer (ACGTGGATCCTTATTTGAACCATAAATTAGGGTAAG) containing a BamHI site.

At the waterfall that morning, I paused on the bridge that loggers must have built a while back, looking downstream.

Herzog was now going to shoot some closeup footage while flowing downstream with the actors.

While the downstream operations will be of interest, we're clear that taking on the iron and steelmaking facilities present a huge challenge.

He and other farmers in the area have focused their attention on the pig farm, because ducks upstream had no problem in the fall, while ducks downstream died en masse.

Chief executive Rex Tillerson described the figures as "solid" and said: "Our results reflect higher crude oil realisations and stronger chemical margins while the downstream industry margins remain weak".