This was due to torsional motion of the strut which was amplified by the secondary actuators.
Feldman didn't approve of his music, which was amplified and improvisatory, and he thought even less of his political militancy.
Christians in Egypt have long felt a deep sense of persecution, which was amplified during the brief period of Brotherhood rule.
One evening, while I was hanging out at my apartment with a Turkish friend, our conversation was interrupted by the call to prayer, which was amplified by loudspeakers.
Even after the establishment of a parliamentary form of government in the nineteenth century, a strong customary element attached to Hungarian law, which was amplified by the association of customary law with national traditions.
Maybe part of it is that a silence surrounded him — the silence produced by the total absence of small talk, flattery, posturing, etc., which was amplified for me by having flown in from the cacophony of New York.
These fragments were ligated to form a fusion product which was amplified further by PCR using forward primer of the left flanking fragment and the reverse primer of the right flanking fragment.
The Pttr-11::nls::venus was made by inserting the ttr-11 promoter, which was amplified with oligonucleotides 5′-ACGGTACCGGAAATGACAGCTG-3′ and 5′- CCGGATCCTTTCTTTGCAAAGATTCG -3′, into the nls::venus vector18.
Sequencing analysis revealed that some of them were human in origin, whereas a 400 bp fragment, which was amplified in all ten patients, corresponded to different bacteria that depended on the patient (Supplementary Table III).
Apinaniz et al.22 reported a large magnetic moment of the A2-disordered phase using calculations, which was amplified by a factor of 1.9 compared with the B2-ordered phase in Fe75Al25 alloys.
"Not only did he abuse his position of trust and authority, which was amplified because he was a celebrity," she said, "he extended it to the whole organization, to the BBC and even the press".
