Sentence examples for which underlined from inspiring English sources

China marked six decades of Communist rule with a parade that had everything – a detachment of women soldiers carrying machine guns and wearing purple mini-skirts, lessons in ideological correctness, nuclear missiles and elaborate fireworks, all of which underlined China's powerful new role in the world.

This time it was a spectacular collapse which underlined why India are favourites for their second World Twenty20 title.

This was the ninth win in a row for the unbeaten English champions and another comprehensive Champions Cup success which underlined their credentials as potential winners.

The heart of Thatcherism, which underlined all Margaret Thatcher's policies, was that government and the public sector were the problem, and markets and business were the solution.

Despite the setting, which underlined the legal jeopardy in which Clemens finds himself, both he and Hardin generally appeared at ease during the arraignment, which lasted less than a half-hour.

Mind you, Geraghty also perpetrated a lovely show-and-go which underlined his bottle and ability, but it was a rare moment of joy on the 23-year-old's first Test start.

In mice the C-terminal residues are KIRRL SA CKQQ, corresponding to residues 426 436 of mouse LKB1 in which the underlined Ser residue is phosphorylated and the underlined Cys residue is farnesylated [ 24– 26].

Mrs. Astor's letter to her executors, however, which bears her underlined signature, "Brooke Russell Astor," and is dated June 9 , 1992 reflects a happy time and a matriarch with no feelings of conflict over her succession.

For supporters, this is proof of his humility, which was further underlined for them in his first address as pope to the masses in St Peter's Square, where he eschewed the usual jewelled crucifix in favour of a simple wooden cross.

Intermediate vector pC3.3 was constructed based on pC3.2 by means of the same mutation protocol mentioned above with primer set 5′CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTTCGAAGGCGGTAATACGGTTATCCACAG 3′ and 5′ AGCCATAGAGCCCACCGCA 3′, by which T7 terminator (underlined sequence) for prokaryotic expression was introduced into a site downstream BGH Poly(A) site.

The poly(A)+mRNA was converted to double-stranded (ds) cDNA by using tagged primers (tag underlined) which contain a NotI restriction site.