Sentence examples for which targeted both from inspiring English sources

The intervention used a 'whole school approach', which targeted both individual (children's) behavior change and also the school environment.

The results verify that a mass vaccination campaign with the 1-dose parenteral Vi vaccine or the menA vaccine, which targeted both school-aged children and adults in Hechi, south China, was logistically feasible and safe.

Toxigenicity status was determined by the Elek test, as recommended by WHO (9 ), and by the polymerase chain reaction (PCR), which targeted both A and B subunits of the tox gene (10 ).

The JNK siRNA, which targets both JNK1 and JNK2, and a non-targeting sequence #2 were both purchased from Dharmacon (Thermo Scientific, Northumberland, UK).

Here, we have designed and synthesized a novel compound which targets both RXR and HADC.

Interestingly, it comes at a time when U.S.-based ZocDoc, which targets both doctor and dentist appointments, and is backed by the likes of DST and Goldman Sachs, looks to be recruiting a UK General Manager as it readies a launch across the pond.

TAS1C produces TTTTGCATATCCTAGAATATA, which targets both TAS2 and TAS1A.

TAS1A produces TTTTGCATATCCTGGAATATG, which targets both TAS1C and TAS2 (Figure 3).

We tested pharmacologic inhibitors of the pathways, which target both the tumor and the bone microenvironment.

This is the first known case of an sRNA in E. coli which targets both in cis (luxS mRNA) and in trans (ompA and phoP mRNAs).

The inhibitor of miR-101 (targeting ATM but not DNAPKcs) or miR-101* (targeting DNA-PKcs but not ATM) partially reversed the sensitivity of the cells over-expressed with miR-101, and combining the two inhibitors almost completely reversed the cell sensitivity (Figure 3C), confirming that the sensitization effects are derived from both strands of miR-101, which target both DNA-PKcs and ATM.