Sentence examples for which are before from inspiring English sources

Exact(10)

Their outsourcing is in addition to the backup/supporting activities, more of their core areas which are before now being retained in-house (Isaksson and Lantz, 2015).

The 5'-3' primers of PCR identification of structural variations of "1,202 Kb translocation" are ACCTGTGGGGATCATTAGCCTCC and ACTCGGATAGTCTAGGTTCGGCGG, which are before 250 bp and after 220 bp of the breakpoint.

Correlation analyses between the VAS value for fatigue and the LF/HF ratio or the ln LF/HF ratio in all the measurement points which are before and after the 8-hr fatigue and relaxation sessions are shown in Figure 1.

The proposition is one of two ballot questions, both of which are before the voters Tuesday because they would amend the Constitution.

But the schedule of the lawsuits may turn out to be as significant as the merits of the cases, which are before Judge John E. Sprizzo.

Lord McNally, the deputy leader of the Lords, responded: "I do not think that it is appropriate from this despatch box to comment on individual cases, some of which are before the courts".

Show more...

Similar(46)

And Nelson Mandela, who was imprisoned for fighting apartheid, was freed in February 1990, which was before -- not after -- the "white government fell".

where k u is the next payment time after time u, and j s is the closest payment time which is before or equal to s.

We assigned samples to two experiment sets, which were "before" and "after treatment".

Data collection for SIS took place in two distinct periods which were before and after the new payment was introduced.

Cholera was four times higher during the summer (April-June) and autumn (October-December), which is before and after the monsoon season respectively.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: