Sentence examples for which append from inspiring English sources

Exact(1)

where b r,q is the qth column of B r, G 1 and G 2 are the matrices which append and remove the cyclic prefix in Equation 5, and (hat {{mathbf {c}}}_{q}) is a N×1 vector with the columns of the estimate (hat {{mathbf {C}}}^{T}).

Similar(59)

The project is sponsored by Intel, which appends a 15-second ad to each minute-long audio clip.

A few years ago, the house was bought by Whitbread, a former brewery turned hospitality company, which appended a sprawling pseudo-Georgian hotel to its rear.

Perhaps the pure of heart are saving their indignation for another new CD: an EMI reissue of Dinu Lipatti's performance of Bach's D minor Concerto with Eduard van Beinum and the Concertgebouw Orchestra, which appends the dreaded "-Busoni" to the great composer's name.

A 1954 documentary short, The Japanese Fishermen, which appended the subsequent BFI DVD release, tied the fantasy of Gojira back to the harsh reality of life in nuclear age, with the fate of the crew of the ironically named Lucky Dragon 5 providing irradiated background inspiration for Honda's fiercely intelligent movie.

As 1 April began in Australia, the company announced its latest stunt: "Gmail Mic Drop", a special version of the send button which appends a gif of a minion (one of the sexless, ageless merchandising icons from the Despicable Me series) dressed as the queen dropping a microphone to the end of your email.

"We might email a subset of that group, look who clicks, opens, buys, which appends back to the data warehouse, which teaches us more.

In today's suit, however, the ACLU claims that such searches violate the California Constitution, which appends a small mountain of protections onto its bigger, badder, federal brother.

The actual appending operation, which appends a new message to the end of a queue, does not update the tail node by changing its pointer so that it points to the new added message node, but recreates recursively each node in the queue, so that instead of writing a small node and a pointer to memory, the function returns, a complete new queue with the newly-added message returns [33, 34].

In order to evaluate the effects of Lpa in vivo, we cloned the lpa gene into an E. coli expression vector which appends a hexa-histidine tag to the amino-terminus of Lpa.

To make RNPs containing linear intron RNA, Ll.LtrB-ΔORF intron RNA was transcribed with phage T3 RNA polymerase from a PCR product generated from pACD3 using the 5' primer T3-LIs (AATTAACCCTCACTAAAGGG TGCGCCCAGATAGGGTGTTAAGTCAAG), which appends a T3 promoter (underlined), and the 3' primer LtrB+940a (GTGAAGTAGGGAGGTACCGCCTTGTTC), which corresponds to the 3' end of the intron.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: