Significantly, he had read Henry More, the Cambridge Platonist, and was thereby introduced to another intellectual world, the magical Hermetic tradition, which sought to explain natural phenomena in terms of alchemical and magical concepts.
The new categories that are thereby introduced – like "complex" or "wicked" – suffer, however, by a lack of shared understanding.
Two additional dimensionless parameters are thereby introduced: m, a power-law index, and R, a geometrical variable based on the inlet and exit radii of the discs.
Explicit couplings of the environment degrees of freedom to the reaction coordinate are thereby introduced at this stage, as conformation-specific reaction coordinates and tunneling paths are calculated for each selected enzyme configuration and are used to compute ensemble averaged Γ and κ coefficients.
His interpretation of the recorded findings might have been influenced by the knowledge of the arm of the study to which the health units were allocated, thereby introducing bias.
To overcome this limitation, macroporous scaffolds of methacrylated dextran (Dex-MA) copolymerized with aminoethyl methacrylate (AEMA) were synthesized, thereby introducing primary amine groups for covalent immobilization of extracellular-matrix-derived peptides.
To amplify the 3′flanking regions of both genes, the primers P3Llod (GGCCGGCCGGGAGCTCAAGGTGTTCAAA) and P4Llod (CAAATTGTTCAAAGCGGGAAC), P3lod (GGCCGGCCGGCAGCAGCCGGTAGTATT) and P4lod (GGGTGCCAACTTATGTCACGA) were used, thereby introducing restriction site for FseI.
As primers (Biolegio, Nijmegen, The Netherlands), 5'-CCCAGCGTGAAAGAGAGAC-3' (forward primer) and 5'-AAATCTAGACTAGCGA-3' (reverse primer) were used, thereby introducing the XbaI restriction site.
The 14 STS cases diagnosed after the study end point may not be representative of all cases if ascertainment was incomplete, thereby introducing potential bias of the risk assessment with RT or CT.
When this is done, much of the structure of the dynamic curve is lost, thereby introducing significant errors in any subsequent pharmacokinetic analysis.
