Sentence examples for were targeted against from inspiring English sources

The two devastating bomb attacks that Lashkar claimed responsibility for were targeted against minority Hazara Shiites in the western city of Quetta on Jan . 10and Feb. 16.

Many remarked that if such attacks were targeted against a religious or racial community they would have caused widespread public revulsion and a much firmer policing response.

Prosecutors also said Mr. Lindh "knew that future terrorist acts were planned, that these were likely to be even worse than the events of Sept. 11 and that these were targeted against his fellow Americans".

These were targeted against the most conserved second exon of HIV-1 TAT/Rev/Env region.

The antibodies used were targeted against the CD3 molecule involved in the transduction of T cell signals after recognition of the antigen.

Morpholinos specific for X. laevis hipk1 were obtained from Gene Tools, LLC (Philomath, OR, USA) and were targeted against nucleotides in the 5'UTR and start codon: Hipk1MO1 (−23 to +1) TACCGCTGGTGTGTTGGGAAGATCA; Hipk1MO2 (−52 to −28) GCTGGTGAGAGGAGCTGCCTGGGAC (Fig. S4A).

"We have no information on who it was targeted against and no information on casualties," he said.

"There's certainly no actual evidence that the worm is targeted against Iran or anybody," he said in an e-mail.

There has also been speculation that some of the attacks may be targeted against the Islamist Haqqani network, a group that has not previously operated outside the region.

"It will be important to see if this kind of vitriol is only targeted against Western media and Westerners, or will it be targeted against any government critics or opposition," said a diplomat in Kabul.

The raid in Verviers in eastern Belgium was targeted against a group of three young men who had recently returned from Syria, according to the Belgian authorities.