Sentence examples for were standardised with from inspiring English sources

Results were standardised with cane toad actin (GenBank Accession no. EL595572) by amplifying a 117 bp fragment using sense 5'- ATGACACAGATAATGTTTGAGAC -3' and antisense 5'- ATCACCAGAGTCCATCACAAT -3' primers.

All observations were standardised with respect to observation time.

The values of VEGF were standardised with cell number.

The levels of VEGF-C were standardised with the corresponding cellular protein concentrations.

Surgical and anaesthetic techniques were standardised, with all patients undergoing spinal anaesthesia.

Incidence rate calculations were standardised with the direct method using the European 2013 standard population.

Indices are standardised with a mean of 0 and a standard deviation of 1.

The scores for BFI-S and Grit-S subscales are standardised with a mean of zero and a standard deviation of one.

In an 'A' grade 100-mL volumetric flask, 100.0361 mg of chromium (III) chloride was dissolved thoroughly and the resultant solution was standardised with EDTA.

"Once you take away all the colour coding and imagery and everything is standardised with massive health warnings, you really do de-glamorise the product".

Hence, the monitoring of ecological effects of GMO must be standardised with regard to parameters, methods, survey intervals and sites so that data are comparable in terms of measurement methods and, thus, can be analysed statistically and interpreted meaningfully [22].