Sentence examples for were sequences from inspiring English sources

Dictionary

were sequences

noun

A set of things next to each other in a set order; a series

Exact(60)

There were sequences of horrific officiating.

The études were sequences of precise muscular movements intended to evoke particular emotions in the performer.

The obtained data were sequences of pictures which were post-processed to detect droplets.

The genes of three calmodulins were sequences in Euglena, one of which was previously known in its protein structure (cal 1).

Upstream of merR and upstream of merT1 were sequences containing potential −35 (ATCAGA) and −10 (GATTAT) and −35 (TTGCAC) and −10 (CATAAT) sequences, and a dyad symmetrical sequence (GCACCTGTAGCCGCTACAGGTTG), respectively, which could be interpreted as an operator/promoter (o/p) sequence (cluster 1, Figure 2).

But -- as happens with every film that Pixar makes -- there were sequences that were created for Cars 2 that, while memorable and entertaining, still wound up hitting the cutting room floor.

This required miners to construct sluices, which were sequences of wooden boxes 15 feet long, through which the dirt would be washed; up to 20 of these might be needed for each mining operation.

Most abundant were sequences representing fragments from thionin genes.

Input for this were sequences corresponding to ascomycete α1 and MATA_HMG domains.

These were sequences nearby L1 at 5' direction from L1 toward gene transcriptional start sites.

Consensus sequences less than 300 bp were removed, as were sequences with BLASTn homology to plant sequences.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: