Sentence examples for were sense from inspiring English sources

Were "Sense" a straight-ahead melodrama, he'd be laughed off the screen, though he's often available for such a risk.

siRNA duplexes that specifically targeted PKM2 were: sense 5'-CAUCUACCACUUGCAAUUATT-3′ and anti-sense 5′- UAAUUGCAAGUGGUAGAUGTT-3′.

The β-actin primer sequences were: sense 5'-CCCTGAAGTACCCCATCGA-3'; antisense 5'- AAGGTGTGGTGCCAGATTTTC-3'.

The IL-7 primer sequences were: sense 5'-TGAAGGTAAAGATGGCAAACAA-3'; antisense 5'-CAATTTCTTTCATGCTGTCCAA-3'.

JunD primers were: sense 5'-CGCCCATCGACATGGACAC-3', antisense 5'-GTTGACGTGGCTGAGGACTT-3'.

Adenosine A2B receptor primers were: sense 5'-TGGCGCTGGAGCTGGTTA-3', antisense 5'-GCAAAGGGGATGGCGAAG-3'.

The oligonucleotide primers used were: sense, 5'- ATCCATTACACACAATCAATTTCTAGC -3'; and antisense, 5'- GCTAGAAATTGATTGTGTGTAATGGAT -3'.

Specific primers for L19 were: sense: 5'-AGTATGCTCAGGCTTCAGAA-3', and antisense: 5'-TTCCTTGGTCTTAGACCTGC-3'.

Monocyte chemotactic protein-1 (Mcp-1) primers were: sense 5'-CCACTCACCTGCTGCTACTC-3', antisense 5'-TTCACATTCAAAGGTGCTGAAG-3'.

The primer sequences for human Zip4 mRNA (Slc39a4) were: sense 5' AAGCACTGCTGCTGAACCTGGCCT 3'; and antisense 5' GATGTCATCCTCGTACAGGGACAGCAGC 3'.

The primer sequences for the human GAPDH mRNA were: sense 5' ACATCATCCCTGCCTCTACTGG 3'; and antisense 5' TCCGACGCCTGCTTCACC 3'.