Nde I and BamH I sites were introduced in forward and reverse primer respectively.
The pe gene was PCR amplified from Haemophilus influenzae genome using primers PENdeI and PEHindIII, while the restriction enzyme sites NdeI and HindIII were introduced into the forward and reverse primer sequences, respectively.
The BglII and HindIII restriction sites were introduced into the forward and reverse primers, respectively.
NcoI and XhoI restriction sites were introduced in the forward and reverse primers, respectively, and are indicated with bold letters.
They were introduced to the forward stepwise (criterion for entry p < 0.05) multivariate Cox proportional hazards model.
Other variables that might influence the follow-up RMDQ score were introduced in a forwards stepwise manner - the most significant variable from the remaining set being introduced at each stage until the introduction of a new variable was not statistically significant at the 5% level.
Different types of relaying strategies, e.g., amplify and forward (AF), decode and forward (DF), and compress and forward (CF) were introduced in [3 5], respectively.
BamHI/EcoRI sites and XhoI sites were introduced at the end of forward and reverse primers respectively (restriction enzyme sites are underlined): SERA3/for (5′-GT GGATCCATGGCACGTCTCTCATCAAT-3′) and SERA3/rev (5′-GT CTCGAGATGTGGTGAAAATTGAACTCTGAA-3′); SERA1/for (5′-GTGT GAATTCTTAGATGCAGCCGACACAAGAATTCTTAGATGCAGCCGACACAAG-3′CGAGTTATCCTTCTCCAGTTGGTTGATG-3′).
The 13 variables were identified through forward search (see Results and Figure 6), and are listed in the order they were introduced into the model during the forward selection procedure (i.e., from most to least important).
In activity 1, students were introduced to programming primitives such as "forward," "right turn," and "left turn" that dealt with the kinematics of motion, primitives like "repeat" which corresponded to a computational construct (independent of a domain construct), and primitives like "pen down" and "pen up" which were Netlogo-specific drawing primitives.
Point mutations were introduced into MST3 by PCR using forward and reverse complementary primer pairs that contained the desired base change(s) flanked by 15 bases on either side.
