Sentence examples for were initially screen from inspiring English sources

Clones were initially screen by PCR using primers BL-TRAP (ACAGATTTGTGAGATAGTCACACAATTC) and BL-DMP1 (GACAATGTTTGCAGACTATGAATGAAG) that flank the linked genomic region.

The PCR fragment was transformed into the strain DS68625-evo and transformants were initially screen on 2 % maltose plate for growth.

First, subjects who responded were initially screened by phone.

A number of commercially available activated carbon products were initially screened using effluent wastewater.

Ninety publicly-available P. monodon microsatellite sequences were initially screened for suitability.

Six designed factors and one uncontrolled factor were initially screened in a fractional factorial design assuming a linear model.

The relevant sintering parameters were initially screened with the 9.5/65/35 composition using a factorial design method to achieve high-density, high purity perovskite-phase, and small grain-size.

Commercial strains of Lactococcus, Lactobacillus, and Bifidobacterium spp. were initially screened on the 6 selective media along with nonstarter LAB (NSLAB) isolates.

The DNA samples of 4 external, unrelated controls were initially screened.

The participants were initially screened for handedness and history of medical, neurological, and psychological problems.

Relevant full-text articles were initially screened by DD to ensure inclusion criteria was met.