Sentence examples for were generated via from inspiring English sources

Exact(60)

Monoclonal antibodies against Akt1 and phospho-Akt at Ser473 were generated via a general method described elsewhere [33].

Mutant pcDNA3-HA-HIF2A full-length constructs were generated via site-directed mutagenesis.

All RNA aptamers were generated via in vitro run-off transcription.

In this paper, new porous thyroxin containing pro-angiogenic hydrogels were generated via freeze gelation protocol.

Long isomalto-oligosaccharides (IMOs) were generated via an engineered fusion enzyme of dextransucrase and dextranase (DSXR).

Human U87 glioma cells expressing either hCB1 (control) or hCB2 were generated via lentiviral transduction.

Most of the price inflation occurred during a 10-year period between 1996 and 2006, while significant dwelling surpluses were generated via exuberant construction and low population growth.

Compounds Layers of TiAl3 and TiAl2 were generated via potentiostatic electrolysis.

USP15 KO, HEK293T, U2OS, and MCF7 cells were generated via CRISPR/CAS9, using Lenti CRISPR V2 containing a gRNA that targeted USP15 (GCGTCGCGATGTCAGACCGC).

As a result of the limited materials available, base-resolution 2-cell embryo DNA methylomes were generated via the published PBAT method20.

Femtosecond X-ray pulses were generated via orthogonal and head-on Thomson scatterings between the electron and laser pulses.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: